Incidental Mutation 'R6277:Prag1'
ID507714
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6277 (G1)
Quality Score216.009
Status Validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36146591 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1099 (R1099L)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect probably damaging
Transcript: ENSMUST00000110492
AA Change: R1099L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: R1099L

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5131:Prag1 UTSW 8 36139969 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5346:Prag1 UTSW 8 36103685 missense probably damaging 1.00
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6240:Prag1 UTSW 8 36103352 missense probably benign 0.03
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7085:Prag1 UTSW 8 36104237 missense possibly damaging 0.71
R7095:Prag1 UTSW 8 36102560 missense probably benign
R7204:Prag1 UTSW 8 36146761 missense probably benign 0.03
R7213:Prag1 UTSW 8 36146615 missense probably damaging 0.99
R7567:Prag1 UTSW 8 36102606 missense possibly damaging 0.68
R7577:Prag1 UTSW 8 36146942 missense probably damaging 1.00
R7783:Prag1 UTSW 8 36103255 missense possibly damaging 0.66
Z1177:Prag1 UTSW 8 36147142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTGCGGCCACTTTGTG -3'
(R):5'- CCTTCAGGAAGTTGCTGATGATG -3'

Sequencing Primer
(F):5'- GTGCCCTCCAGCATGCTTG -3'
(R):5'- CTGATGATGAGCCTGGGCAG -3'
Posted On2018-03-15