Incidental Mutation 'R6277:Crybg1'
ID507724
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6277 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43997259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1284 (E1284D)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably benign
Transcript: ENSMUST00000020017
AA Change: E910D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: E910D

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: E1284D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: E1284D

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
R8359:Crybg1 UTSW 10 43992542 missense probably benign 0.03
R8751:Crybg1 UTSW 10 44004842 missense probably benign 0.04
R8809:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATACCGGCTTGCTTTG -3'
(R):5'- GACGTCAGTCAACACAATGAGC -3'

Sequencing Primer
(F):5'- CTTGCTTTGAAAAGGCCCAG -3'
(R):5'- CGTATCTCAGTCATCAGTGGTACAG -3'
Posted On2018-03-15