Incidental Mutation 'R6277:Hormad2'
ID 507728
Institutional Source Beutler Lab
Gene Symbol Hormad2
Ensembl Gene ENSMUSG00000020419
Gene Name HORMA domain containing 2
Synonyms 4930529M09Rik
MMRRC Submission 044447-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R6277 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 4295814-4391105 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to T at 4371583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020689] [ENSMUST00000109948] [ENSMUST00000109949] [ENSMUST00000130174]
AlphaFold Q5SQP1
Predicted Effect probably benign
Transcript: ENSMUST00000020689
SMART Domains Protein: ENSMUSP00000020689
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 27 65 1.9e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109948
SMART Domains Protein: ENSMUSP00000105574
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 28 226 8.3e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109949
SMART Domains Protein: ENSMUSP00000105575
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 27 226 6.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130174
SMART Domains Protein: ENSMUSP00000121715
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 27 103 6.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149443
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to arrest of spermatogenesis, male infertility, and abnormalities in male and female meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,385,651 (GRCm39) Y105H possibly damaging Het
4921539E11Rik A T 4: 103,088,668 (GRCm39) Y179* probably null Het
Abca7 G C 10: 79,841,992 (GRCm39) V1042L probably benign Het
Adck5 C A 15: 76,477,463 (GRCm39) T99K possibly damaging Het
Adcy5 A G 16: 35,109,896 (GRCm39) T823A probably benign Het
Adra1d G T 2: 131,403,083 (GRCm39) R336S probably damaging Het
Arhgap39 A T 15: 76,619,337 (GRCm39) M749K probably damaging Het
Arid4a A G 12: 71,086,665 (GRCm39) R168G possibly damaging Het
Atxn10 A G 15: 85,275,893 (GRCm39) T317A probably benign Het
Bicc1 T C 10: 70,863,731 (GRCm39) K22E possibly damaging Het
Cacna1b T G 2: 24,620,808 (GRCm39) T281P probably damaging Het
Ccdc174 A T 6: 91,857,272 (GRCm39) Q26L probably damaging Het
Celf3 T C 3: 94,392,672 (GRCm39) C124R probably damaging Het
Cfap44 A G 16: 44,257,669 (GRCm39) E1068G probably benign Het
Crybg1 T A 10: 43,873,255 (GRCm39) E1284D probably benign Het
Dcbld2 T A 16: 58,272,119 (GRCm39) Y392N probably damaging Het
Dcbld2 C T 16: 58,285,866 (GRCm39) P675L probably damaging Het
Dnah12 A T 14: 26,492,439 (GRCm39) H1193L probably damaging Het
Efcab3 G C 11: 104,901,148 (GRCm39) E4422D possibly damaging Het
Ern2 A G 7: 121,785,330 (GRCm39) F16L probably benign Het
Fam163b G T 2: 27,002,763 (GRCm39) T78N probably benign Het
Fbxw21 A T 9: 108,974,623 (GRCm39) I299K possibly damaging Het
Foxg1 A G 12: 49,432,299 (GRCm39) N344S probably benign Het
Git2 A G 5: 114,871,308 (GRCm39) I202T probably damaging Het
Gm11595 G T 11: 99,663,510 (GRCm39) P57T unknown Het
Gm12258 G A 11: 58,745,113 (GRCm39) V15M probably damaging Het
Gm15056 C T 8: 21,390,914 (GRCm39) G40S probably damaging Het
Gnal C A 18: 67,346,143 (GRCm39) H274Q probably damaging Het
Ighv7-2 A G 12: 113,876,087 (GRCm39) I6T probably benign Het
Irf9 A G 14: 55,845,109 (GRCm39) D323G probably benign Het
Klhl23 G T 2: 69,664,096 (GRCm39) D482Y probably damaging Het
Lama4 A G 10: 38,982,006 (GRCm39) N1745S probably damaging Het
Lct T A 1: 128,231,974 (GRCm39) Y625F probably benign Het
Lrrc26 T C 2: 25,180,116 (GRCm39) V39A probably benign Het
Mllt6 G A 11: 97,564,774 (GRCm39) A527T probably damaging Het
Mrgprb4 T A 7: 47,848,649 (GRCm39) D93V probably benign Het
Nlrp5 A G 7: 23,120,880 (GRCm39) D698G probably damaging Het
Or13p10 T A 4: 118,523,520 (GRCm39) S269T probably benign Het
Pacsin1 T A 17: 27,924,969 (GRCm39) probably null Het
Padi3 A T 4: 140,518,472 (GRCm39) probably null Het
Pcdha8 T C 18: 37,127,411 (GRCm39) I631T probably damaging Het
Pkn3 G A 2: 29,972,957 (GRCm39) G315D possibly damaging Het
Ppfibp1 T A 6: 146,907,422 (GRCm39) D228E probably benign Het
Prag1 G T 8: 36,613,745 (GRCm39) R1099L probably damaging Het
Pramel31 A G 4: 144,090,223 (GRCm39) E421G probably damaging Het
Prr36 A G 8: 4,264,746 (GRCm39) probably benign Het
Prrc2c A G 1: 162,541,883 (GRCm39) S369P probably benign Het
Ptprn2 A G 12: 116,839,800 (GRCm39) D441G probably benign Het
Slc9c1 G A 16: 45,427,204 (GRCm39) probably benign Het
Slit1 G A 19: 41,588,948 (GRCm39) T1513I possibly damaging Het
Smcr8 C T 11: 60,669,635 (GRCm39) T261M probably benign Het
Spata17 G A 1: 186,926,151 (GRCm39) R60* probably null Het
Speer4f1 A G 5: 17,681,241 (GRCm39) R40G probably damaging Het
Spns3 A G 11: 72,420,466 (GRCm39) V340A possibly damaging Het
Srgap3 T C 6: 112,716,344 (GRCm39) I595V probably benign Het
Srms G A 2: 180,848,038 (GRCm39) A489V possibly damaging Het
St3gal4 T C 9: 34,964,558 (GRCm39) N169S probably damaging Het
Taar5 T A 10: 23,847,169 (GRCm39) V189E probably damaging Het
Tbc1d32 G A 10: 56,071,525 (GRCm39) P333L probably benign Het
Tet3 G T 6: 83,345,066 (GRCm39) Y1790* probably null Het
Ticrr T A 7: 79,344,444 (GRCm39) H1436Q probably benign Het
Top6bl G T 19: 4,677,250 (GRCm39) S466* probably null Het
Ubl7 C T 9: 57,830,555 (GRCm39) L334F possibly damaging Het
Unc13a A G 8: 72,119,283 (GRCm39) probably null Het
Unc13c T C 9: 73,606,451 (GRCm39) D1303G probably damaging Het
Vmn2r114 A G 17: 23,509,954 (GRCm39) L842P possibly damaging Het
Vps35 G T 8: 85,987,857 (GRCm39) Q765K possibly damaging Het
Zfp87 G T 13: 74,520,643 (GRCm39) S145* probably null Het
Zgrf1 C T 3: 127,392,461 (GRCm39) A1327V possibly damaging Het
Zkscan6 T A 11: 65,718,983 (GRCm39) S334R probably benign Het
Other mutations in Hormad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02245:Hormad2 APN 11 4,358,580 (GRCm39) splice site probably benign
R0116:Hormad2 UTSW 11 4,362,206 (GRCm39) splice site probably benign
R0504:Hormad2 UTSW 11 4,358,833 (GRCm39) missense possibly damaging 0.78
R0925:Hormad2 UTSW 11 4,377,297 (GRCm39) missense probably damaging 1.00
R1344:Hormad2 UTSW 11 4,359,005 (GRCm39) critical splice donor site probably null
R1418:Hormad2 UTSW 11 4,359,005 (GRCm39) critical splice donor site probably null
R1512:Hormad2 UTSW 11 4,374,788 (GRCm39) missense probably damaging 1.00
R1562:Hormad2 UTSW 11 4,358,848 (GRCm39) splice site probably null
R2158:Hormad2 UTSW 11 4,374,808 (GRCm39) nonsense probably null
R3405:Hormad2 UTSW 11 4,374,302 (GRCm39) missense probably damaging 1.00
R3727:Hormad2 UTSW 11 4,358,598 (GRCm39) missense probably benign
R3903:Hormad2 UTSW 11 4,377,237 (GRCm39) splice site probably benign
R7468:Hormad2 UTSW 11 4,362,245 (GRCm39) nonsense probably null
R7633:Hormad2 UTSW 11 4,296,662 (GRCm39) missense probably benign 0.00
R7912:Hormad2 UTSW 11 4,358,841 (GRCm39) missense probably damaging 1.00
R8129:Hormad2 UTSW 11 4,296,648 (GRCm39) missense probably benign 0.02
R8306:Hormad2 UTSW 11 4,358,714 (GRCm39) missense probably benign 0.32
R9625:Hormad2 UTSW 11 4,377,372 (GRCm39) missense probably damaging 1.00
R9626:Hormad2 UTSW 11 4,377,372 (GRCm39) missense probably damaging 1.00
R9628:Hormad2 UTSW 11 4,377,372 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGACTTTGGATCTGTTACATATC -3'
(R):5'- CCCAGTAAAGCCAGTGTTTGTA -3'

Sequencing Primer
(F):5'- CTCTCATATGATATGTTCTCTCA -3'
(R):5'- AAAGCCAGTGTTTGTAATAGAAATTG -3'
Posted On 2018-03-15