Incidental Mutation 'R6277:Smcr8'
ID507730
Institutional Source Beutler Lab
Gene Symbol Smcr8
Ensembl Gene ENSMUSG00000049323
Gene NameSmith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms2310076G09Rik, D030073L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6277 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60777524-60788287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60778809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 261 (T261M)
Ref Sequence ENSEMBL: ENSMUSP00000055926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000056907] [ENSMUST00000102667] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably benign
Transcript: ENSMUST00000002891
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056907
AA Change: T261M

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: T261M

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102667
AA Change: T261M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: T261M

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Smcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60779988 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGCAACAGGAAGGCATTC -3'
(R):5'- ACTTCTTGTCAAAACACTTGGTGG -3'

Sequencing Primer
(F):5'- GACTTGGATTACACAAGGACAGTGC -3'
(R):5'- GTCAAAACACTTGGTGGACTTTGC -3'
Posted On2018-03-15