Incidental Mutation 'R6277:Efcab3'
ID 507735
Institutional Source Beutler Lab
Gene Symbol Efcab3
Ensembl Gene ENSMUSG00000020690
Gene Name EF-hand calcium binding domain 3
Synonyms Gm11639, Efcab13, 4921510J17Rik, Efcab15, Gm11639
MMRRC Submission 044447-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6277 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104954418-105008363 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 104901148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 4422 (E4422D)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000212287]
AlphaFold Q80X60
Predicted Effect possibly damaging
Transcript: ENSMUST00000212287
AA Change: E4422D

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,385,651 (GRCm39) Y105H possibly damaging Het
4921539E11Rik A T 4: 103,088,668 (GRCm39) Y179* probably null Het
Abca7 G C 10: 79,841,992 (GRCm39) V1042L probably benign Het
Adck5 C A 15: 76,477,463 (GRCm39) T99K possibly damaging Het
Adcy5 A G 16: 35,109,896 (GRCm39) T823A probably benign Het
Adra1d G T 2: 131,403,083 (GRCm39) R336S probably damaging Het
Arhgap39 A T 15: 76,619,337 (GRCm39) M749K probably damaging Het
Arid4a A G 12: 71,086,665 (GRCm39) R168G possibly damaging Het
Atxn10 A G 15: 85,275,893 (GRCm39) T317A probably benign Het
Bicc1 T C 10: 70,863,731 (GRCm39) K22E possibly damaging Het
Cacna1b T G 2: 24,620,808 (GRCm39) T281P probably damaging Het
Ccdc174 A T 6: 91,857,272 (GRCm39) Q26L probably damaging Het
Celf3 T C 3: 94,392,672 (GRCm39) C124R probably damaging Het
Cfap44 A G 16: 44,257,669 (GRCm39) E1068G probably benign Het
Crybg1 T A 10: 43,873,255 (GRCm39) E1284D probably benign Het
Dcbld2 T A 16: 58,272,119 (GRCm39) Y392N probably damaging Het
Dcbld2 C T 16: 58,285,866 (GRCm39) P675L probably damaging Het
Dnah12 A T 14: 26,492,439 (GRCm39) H1193L probably damaging Het
Ern2 A G 7: 121,785,330 (GRCm39) F16L probably benign Het
Fam163b G T 2: 27,002,763 (GRCm39) T78N probably benign Het
Fbxw21 A T 9: 108,974,623 (GRCm39) I299K possibly damaging Het
Foxg1 A G 12: 49,432,299 (GRCm39) N344S probably benign Het
Git2 A G 5: 114,871,308 (GRCm39) I202T probably damaging Het
Gm11595 G T 11: 99,663,510 (GRCm39) P57T unknown Het
Gm12258 G A 11: 58,745,113 (GRCm39) V15M probably damaging Het
Gm15056 C T 8: 21,390,914 (GRCm39) G40S probably damaging Het
Gnal C A 18: 67,346,143 (GRCm39) H274Q probably damaging Het
Hormad2 A T 11: 4,371,583 (GRCm39) probably null Het
Ighv7-2 A G 12: 113,876,087 (GRCm39) I6T probably benign Het
Irf9 A G 14: 55,845,109 (GRCm39) D323G probably benign Het
Klhl23 G T 2: 69,664,096 (GRCm39) D482Y probably damaging Het
Lama4 A G 10: 38,982,006 (GRCm39) N1745S probably damaging Het
Lct T A 1: 128,231,974 (GRCm39) Y625F probably benign Het
Lrrc26 T C 2: 25,180,116 (GRCm39) V39A probably benign Het
Mllt6 G A 11: 97,564,774 (GRCm39) A527T probably damaging Het
Mrgprb4 T A 7: 47,848,649 (GRCm39) D93V probably benign Het
Nlrp5 A G 7: 23,120,880 (GRCm39) D698G probably damaging Het
Or13p10 T A 4: 118,523,520 (GRCm39) S269T probably benign Het
Pacsin1 T A 17: 27,924,969 (GRCm39) probably null Het
Padi3 A T 4: 140,518,472 (GRCm39) probably null Het
Pcdha8 T C 18: 37,127,411 (GRCm39) I631T probably damaging Het
Pkn3 G A 2: 29,972,957 (GRCm39) G315D possibly damaging Het
Ppfibp1 T A 6: 146,907,422 (GRCm39) D228E probably benign Het
Prag1 G T 8: 36,613,745 (GRCm39) R1099L probably damaging Het
Pramel31 A G 4: 144,090,223 (GRCm39) E421G probably damaging Het
Prr36 A G 8: 4,264,746 (GRCm39) probably benign Het
Prrc2c A G 1: 162,541,883 (GRCm39) S369P probably benign Het
Ptprn2 A G 12: 116,839,800 (GRCm39) D441G probably benign Het
Slc9c1 G A 16: 45,427,204 (GRCm39) probably benign Het
Slit1 G A 19: 41,588,948 (GRCm39) T1513I possibly damaging Het
Smcr8 C T 11: 60,669,635 (GRCm39) T261M probably benign Het
Spata17 G A 1: 186,926,151 (GRCm39) R60* probably null Het
Speer4f1 A G 5: 17,681,241 (GRCm39) R40G probably damaging Het
Spns3 A G 11: 72,420,466 (GRCm39) V340A possibly damaging Het
Srgap3 T C 6: 112,716,344 (GRCm39) I595V probably benign Het
Srms G A 2: 180,848,038 (GRCm39) A489V possibly damaging Het
St3gal4 T C 9: 34,964,558 (GRCm39) N169S probably damaging Het
Taar5 T A 10: 23,847,169 (GRCm39) V189E probably damaging Het
Tbc1d32 G A 10: 56,071,525 (GRCm39) P333L probably benign Het
Tet3 G T 6: 83,345,066 (GRCm39) Y1790* probably null Het
Ticrr T A 7: 79,344,444 (GRCm39) H1436Q probably benign Het
Top6bl G T 19: 4,677,250 (GRCm39) S466* probably null Het
Ubl7 C T 9: 57,830,555 (GRCm39) L334F possibly damaging Het
Unc13a A G 8: 72,119,283 (GRCm39) probably null Het
Unc13c T C 9: 73,606,451 (GRCm39) D1303G probably damaging Het
Vmn2r114 A G 17: 23,509,954 (GRCm39) L842P possibly damaging Het
Vps35 G T 8: 85,987,857 (GRCm39) Q765K possibly damaging Het
Zfp87 G T 13: 74,520,643 (GRCm39) S145* probably null Het
Zgrf1 C T 3: 127,392,461 (GRCm39) A1327V possibly damaging Het
Zkscan6 T A 11: 65,718,983 (GRCm39) S334R probably benign Het
Other mutations in Efcab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Efcab3 APN 11 104,990,847 (GRCm39) missense probably damaging 1.00
IGL01308:Efcab3 APN 11 104,611,523 (GRCm39) missense probably benign 0.03
IGL01483:Efcab3 APN 11 104,630,173 (GRCm39) missense probably benign 0.03
IGL01695:Efcab3 APN 11 104,626,889 (GRCm39) missense probably damaging 1.00
IGL01860:Efcab3 APN 11 104,581,747 (GRCm39) missense probably benign 0.16
IGL01981:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL01984:Efcab3 APN 11 104,629,134 (GRCm39) missense probably benign 0.20
IGL02023:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL02252:Efcab3 APN 11 104,644,753 (GRCm39) missense possibly damaging 0.68
IGL02886:Efcab3 APN 11 104,986,700 (GRCm39) missense possibly damaging 0.95
IGL03116:Efcab3 APN 11 104,612,359 (GRCm39) missense probably benign 0.02
IGL03141:Efcab3 APN 11 104,986,696 (GRCm39) missense probably damaging 0.99
IGL03242:Efcab3 APN 11 104,997,230 (GRCm39) missense probably damaging 1.00
IGL03274:Efcab3 APN 11 104,611,919 (GRCm39) missense probably benign 0.03
IGL03408:Efcab3 APN 11 104,601,447 (GRCm39) missense probably benign 0.03
PIT4812001:Efcab3 UTSW 11 104,990,805 (GRCm39) missense probably null 0.00
R0018:Efcab3 UTSW 11 104,612,378 (GRCm39) critical splice donor site probably null
R0068:Efcab3 UTSW 11 104,611,648 (GRCm39) missense probably benign 0.29
R0350:Efcab3 UTSW 11 104,581,706 (GRCm39) missense probably benign 0.03
R0388:Efcab3 UTSW 11 105,000,227 (GRCm39) missense possibly damaging 0.61
R0646:Efcab3 UTSW 11 104,611,327 (GRCm39) missense probably benign 0.03
R0668:Efcab3 UTSW 11 104,611,318 (GRCm39) missense probably benign 0.16
R0715:Efcab3 UTSW 11 104,611,706 (GRCm39) missense possibly damaging 0.90
R0944:Efcab3 UTSW 11 104,601,556 (GRCm39) splice site probably null
R1330:Efcab3 UTSW 11 104,637,116 (GRCm39) missense possibly damaging 0.84
R1440:Efcab3 UTSW 11 104,999,581 (GRCm39) splice site probably benign
R1508:Efcab3 UTSW 11 104,601,503 (GRCm39) missense probably benign 0.03
R1540:Efcab3 UTSW 11 104,999,726 (GRCm39) missense probably benign 0.07
R1643:Efcab3 UTSW 11 104,589,804 (GRCm39) missense probably benign 0.16
R1651:Efcab3 UTSW 11 104,611,492 (GRCm39) missense probably benign 0.03
R1665:Efcab3 UTSW 11 104,611,940 (GRCm39) missense probably benign 0.07
R1702:Efcab3 UTSW 11 104,581,832 (GRCm39) missense probably benign 0.03
R1711:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1779:Efcab3 UTSW 11 104,611,765 (GRCm39) missense probably benign 0.15
R1813:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1818:Efcab3 UTSW 11 104,612,333 (GRCm39) missense probably benign 0.10
R1896:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1969:Efcab3 UTSW 11 104,637,090 (GRCm39) missense probably damaging 1.00
R2029:Efcab3 UTSW 11 104,990,851 (GRCm39) missense probably damaging 0.99
R2139:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R2165:Efcab3 UTSW 11 104,642,688 (GRCm39) missense possibly damaging 0.93
R2359:Efcab3 UTSW 11 104,630,106 (GRCm39) missense possibly damaging 0.80
R2394:Efcab3 UTSW 11 104,629,121 (GRCm39) missense probably benign 0.17
R2401:Efcab3 UTSW 11 104,963,144 (GRCm39) critical splice donor site probably null
R2406:Efcab3 UTSW 11 104,611,457 (GRCm39) missense probably benign 0.03
R2570:Efcab3 UTSW 11 104,624,490 (GRCm39) missense probably damaging 1.00
R3795:Efcab3 UTSW 11 104,624,501 (GRCm39) missense possibly damaging 0.94
R3901:Efcab3 UTSW 11 104,974,713 (GRCm39) missense possibly damaging 0.68
R4244:Efcab3 UTSW 11 105,002,629 (GRCm39) missense probably damaging 1.00
R4352:Efcab3 UTSW 11 104,630,140 (GRCm39) missense probably null 0.25
R4359:Efcab3 UTSW 11 104,624,547 (GRCm39) splice site probably null
R4424:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably null
R4895:Efcab3 UTSW 11 105,008,227 (GRCm39) unclassified probably benign
R4895:Efcab3 UTSW 11 104,640,496 (GRCm39) missense probably damaging 1.00
R4895:Efcab3 UTSW 11 104,611,112 (GRCm39) missense probably benign 0.16
R5006:Efcab3 UTSW 11 104,620,503 (GRCm39) splice site probably null
R5066:Efcab3 UTSW 11 104,611,490 (GRCm39) missense probably benign 0.03
R5316:Efcab3 UTSW 11 104,967,286 (GRCm39) missense possibly damaging 0.80
R5329:Efcab3 UTSW 11 104,644,632 (GRCm39) splice site probably null
R5405:Efcab3 UTSW 11 104,612,018 (GRCm39) missense probably benign 0.07
R5814:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably benign
R5888:Efcab3 UTSW 11 104,612,227 (GRCm39) splice site probably benign
R5910:Efcab3 UTSW 11 104,581,760 (GRCm39) missense probably benign 0.01
R5975:Efcab3 UTSW 11 104,578,375 (GRCm39) start gained probably benign
R6019:Efcab3 UTSW 11 104,933,728 (GRCm39) critical splice donor site probably null
R6028:Efcab3 UTSW 11 104,660,481 (GRCm39) critical splice donor site probably null
R6048:Efcab3 UTSW 11 104,835,259 (GRCm39) missense unknown
R6059:Efcab3 UTSW 11 104,927,595 (GRCm39) missense probably benign 0.03
R6147:Efcab3 UTSW 11 104,858,566 (GRCm39) missense unknown
R6176:Efcab3 UTSW 11 104,683,383 (GRCm39) missense probably benign 0.16
R6181:Efcab3 UTSW 11 104,722,159 (GRCm39) missense probably benign 0.25
R6196:Efcab3 UTSW 11 104,746,386 (GRCm39) missense probably benign 0.07
R6245:Efcab3 UTSW 11 104,675,834 (GRCm39) missense probably benign 0.03
R6262:Efcab3 UTSW 11 104,784,579 (GRCm39) missense probably benign 0.24
R6263:Efcab3 UTSW 11 104,810,312 (GRCm39) missense unknown
R6338:Efcab3 UTSW 11 104,734,034 (GRCm39) nonsense probably null
R6355:Efcab3 UTSW 11 104,896,511 (GRCm39) missense probably benign 0.29
R6356:Efcab3 UTSW 11 104,784,533 (GRCm39) missense probably benign 0.19
R6365:Efcab3 UTSW 11 104,815,412 (GRCm39) missense unknown
R6378:Efcab3 UTSW 11 104,999,620 (GRCm39) missense possibly damaging 0.83
R6391:Efcab3 UTSW 11 104,885,143 (GRCm39) missense possibly damaging 0.92
R6494:Efcab3 UTSW 11 104,990,845 (GRCm39) missense possibly damaging 0.93
R6556:Efcab3 UTSW 11 104,899,077 (GRCm39) missense probably null 0.03
R6573:Efcab3 UTSW 11 104,971,461 (GRCm39) missense possibly damaging 0.91
R6604:Efcab3 UTSW 11 104,589,772 (GRCm39) nonsense probably null
R6605:Efcab3 UTSW 11 104,890,107 (GRCm39) splice site probably null
R6634:Efcab3 UTSW 11 104,784,609 (GRCm39) missense probably benign 0.17
R6723:Efcab3 UTSW 11 105,007,906 (GRCm39) missense possibly damaging 0.95
R6851:Efcab3 UTSW 11 104,896,521 (GRCm39) missense probably benign 0.03
R6862:Efcab3 UTSW 11 104,612,284 (GRCm39) nonsense probably null
R6949:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 1.00
R6970:Efcab3 UTSW 11 104,667,182 (GRCm39) missense probably benign 0.03
R7014:Efcab3 UTSW 11 104,584,248 (GRCm39) missense probably benign 0.03
R7097:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7122:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7124:Efcab3 UTSW 11 104,629,100 (GRCm39) missense probably benign 0.17
R7146:Efcab3 UTSW 11 104,913,764 (GRCm39) missense probably benign 0.03
R7146:Efcab3 UTSW 11 104,858,578 (GRCm39) missense unknown
R7154:Efcab3 UTSW 11 104,589,966 (GRCm39) splice site probably null
R7175:Efcab3 UTSW 11 104,838,237 (GRCm39) missense unknown
R7189:Efcab3 UTSW 11 104,986,690 (GRCm39) missense probably benign
R7198:Efcab3 UTSW 11 104,642,711 (GRCm39) missense probably benign 0.15
R7211:Efcab3 UTSW 11 104,615,435 (GRCm39) critical splice donor site probably null
R7211:Efcab3 UTSW 11 104,601,539 (GRCm39) missense probably benign 0.01
R7216:Efcab3 UTSW 11 104,771,375 (GRCm39) missense possibly damaging 0.49
R7221:Efcab3 UTSW 11 104,791,432 (GRCm39) missense probably benign 0.36
R7233:Efcab3 UTSW 11 104,730,669 (GRCm39) missense possibly damaging 0.69
R7236:Efcab3 UTSW 11 104,790,093 (GRCm39) missense probably benign 0.10
R7262:Efcab3 UTSW 11 104,745,432 (GRCm39) critical splice donor site probably null
R7289:Efcab3 UTSW 11 104,929,184 (GRCm39) missense probably benign 0.24
R7323:Efcab3 UTSW 11 104,920,837 (GRCm39) missense probably benign 0.07
R7378:Efcab3 UTSW 11 104,605,528 (GRCm39) missense probably benign 0.03
R7388:Efcab3 UTSW 11 104,611,871 (GRCm39) missense probably damaging 0.97
R7390:Efcab3 UTSW 11 104,615,411 (GRCm39) missense possibly damaging 0.46
R7411:Efcab3 UTSW 11 104,890,549 (GRCm39) missense probably benign 0.10
R7468:Efcab3 UTSW 11 104,640,526 (GRCm39) missense probably benign 0.17
R7483:Efcab3 UTSW 11 105,000,112 (GRCm39) missense probably benign 0.39
R7497:Efcab3 UTSW 11 104,653,516 (GRCm39) critical splice donor site probably null
R7612:Efcab3 UTSW 11 104,999,647 (GRCm39) missense possibly damaging 0.80
R7620:Efcab3 UTSW 11 104,722,969 (GRCm39) missense possibly damaging 0.95
R7638:Efcab3 UTSW 11 104,927,625 (GRCm39) missense probably benign 0.03
R7661:Efcab3 UTSW 11 104,617,503 (GRCm39) missense probably benign 0.03
R7667:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R7682:Efcab3 UTSW 11 104,855,174 (GRCm39) splice site probably null
R7708:Efcab3 UTSW 11 104,855,397 (GRCm39) missense unknown
R7719:Efcab3 UTSW 11 105,002,674 (GRCm39) missense probably benign 0.14
R7721:Efcab3 UTSW 11 104,615,366 (GRCm39) nonsense probably null
R7735:Efcab3 UTSW 11 104,962,465 (GRCm39) missense probably benign
R7747:Efcab3 UTSW 11 104,733,429 (GRCm39) missense probably damaging 0.96
R7840:Efcab3 UTSW 11 104,624,539 (GRCm39) missense probably benign 0.07
R7846:Efcab3 UTSW 11 104,605,571 (GRCm39) critical splice donor site probably null
R7893:Efcab3 UTSW 11 104,870,186 (GRCm39) missense unknown
R7895:Efcab3 UTSW 11 105,008,150 (GRCm39) missense probably benign 0.29
R7897:Efcab3 UTSW 11 104,889,061 (GRCm39) missense probably benign 0.24
R7936:Efcab3 UTSW 11 104,937,385 (GRCm39) critical splice donor site probably null
R7936:Efcab3 UTSW 11 104,890,524 (GRCm39) missense possibly damaging 0.89
R7959:Efcab3 UTSW 11 104,933,627 (GRCm39) missense probably damaging 0.96
R8031:Efcab3 UTSW 11 104,772,295 (GRCm39) missense possibly damaging 0.49
R8041:Efcab3 UTSW 11 104,810,305 (GRCm39) missense unknown
R8054:Efcab3 UTSW 11 104,621,226 (GRCm39) missense probably benign 0.07
R8056:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 0.98
R8061:Efcab3 UTSW 11 104,997,275 (GRCm39) missense probably benign 0.00
R8088:Efcab3 UTSW 11 104,889,072 (GRCm39) missense probably benign 0.10
R8112:Efcab3 UTSW 11 104,841,026 (GRCm39) missense unknown
R8116:Efcab3 UTSW 11 105,002,677 (GRCm39) missense possibly damaging 0.65
R8340:Efcab3 UTSW 11 104,876,856 (GRCm39) missense unknown
R8405:Efcab3 UTSW 11 104,612,024 (GRCm39) missense probably benign 0.02
R8413:Efcab3 UTSW 11 104,811,135 (GRCm39) missense unknown
R8472:Efcab3 UTSW 11 104,709,463 (GRCm39) missense probably benign 0.07
R8549:Efcab3 UTSW 11 104,890,521 (GRCm39) missense probably damaging 0.99
R8699:Efcab3 UTSW 11 104,672,072 (GRCm39) missense probably benign 0.03
R8711:Efcab3 UTSW 11 104,743,371 (GRCm39) missense probably benign 0.03
R8732:Efcab3 UTSW 11 104,695,100 (GRCm39) missense probably benign 0.03
R8745:Efcab3 UTSW 11 104,749,304 (GRCm39) missense possibly damaging 0.57
R8806:Efcab3 UTSW 11 104,928,695 (GRCm39) missense probably benign 0.07
R8810:Efcab3 UTSW 11 104,805,721 (GRCm39) missense unknown
R8845:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R8870:Efcab3 UTSW 11 104,791,500 (GRCm39) missense probably benign 0.07
R8872:Efcab3 UTSW 11 104,760,880 (GRCm39) missense probably benign 0.19
R8879:Efcab3 UTSW 11 104,581,781 (GRCm39) missense probably benign 0.03
R8924:Efcab3 UTSW 11 104,806,253 (GRCm39) frame shift probably null
R8954:Efcab3 UTSW 11 104,909,525 (GRCm39) critical splice donor site probably null
R8960:Efcab3 UTSW 11 104,820,772 (GRCm39) splice site probably benign
R8975:Efcab3 UTSW 11 104,954,415 (GRCm39) missense probably benign 0.17
R8988:Efcab3 UTSW 11 104,911,352 (GRCm39) missense probably benign 0.07
R8998:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R8999:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R9002:Efcab3 UTSW 11 104,920,822 (GRCm39) missense probably damaging 0.99
R9012:Efcab3 UTSW 11 104,711,347 (GRCm39) critical splice donor site probably null
R9036:Efcab3 UTSW 11 104,927,601 (GRCm39) missense probably benign 0.03
R9037:Efcab3 UTSW 11 104,803,791 (GRCm39) missense unknown
R9059:Efcab3 UTSW 11 104,642,689 (GRCm39) missense possibly damaging 0.73
R9066:Efcab3 UTSW 11 104,631,688 (GRCm39) intron probably benign
R9122:Efcab3 UTSW 11 104,856,605 (GRCm39) missense unknown
R9125:Efcab3 UTSW 11 104,736,360 (GRCm39) missense probably damaging 1.00
R9127:Efcab3 UTSW 11 104,741,407 (GRCm39) missense probably benign 0.07
R9171:Efcab3 UTSW 11 104,800,708 (GRCm39) missense probably benign 0.36
R9219:Efcab3 UTSW 11 104,836,691 (GRCm39) missense unknown
R9224:Efcab3 UTSW 11 104,661,801 (GRCm39) missense probably benign 0.07
R9235:Efcab3 UTSW 11 104,907,987 (GRCm39) missense probably benign 0.19
R9294:Efcab3 UTSW 11 104,722,126 (GRCm39) missense probably benign 0.24
R9318:Efcab3 UTSW 11 104,856,648 (GRCm39) critical splice donor site probably null
R9322:Efcab3 UTSW 11 104,765,199 (GRCm39) missense probably benign 0.36
R9361:Efcab3 UTSW 11 104,896,524 (GRCm39) missense probably benign 0.03
R9408:Efcab3 UTSW 11 104,621,255 (GRCm39) critical splice donor site probably null
R9434:Efcab3 UTSW 11 104,899,863 (GRCm39) missense probably benign 0.24
R9477:Efcab3 UTSW 11 104,836,698 (GRCm39) missense unknown
R9658:Efcab3 UTSW 11 104,611,120 (GRCm39) missense probably benign 0.03
R9719:Efcab3 UTSW 11 104,867,912 (GRCm39) missense unknown
R9751:Efcab3 UTSW 11 104,783,911 (GRCm39) missense probably benign 0.19
R9763:Efcab3 UTSW 11 104,890,485 (GRCm39) missense possibly damaging 0.89
X0026:Efcab3 UTSW 11 105,007,937 (GRCm39) missense probably benign 0.03
X0026:Efcab3 UTSW 11 104,611,801 (GRCm39) missense probably benign 0.07
Z1088:Efcab3 UTSW 11 104,642,728 (GRCm39) missense probably damaging 0.96
Z1176:Efcab3 UTSW 11 104,990,872 (GRCm39) missense probably damaging 1.00
Z1176:Efcab3 UTSW 11 104,892,793 (GRCm39) missense probably benign 0.29
Z1176:Efcab3 UTSW 11 104,999,598 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,711,344 (GRCm39) missense probably benign 0.03
Z1177:Efcab3 UTSW 11 104,630,164 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,814,845 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTGGGCACTTGAACATTTG -3'
(R):5'- CCAAAATGTGCTCTTACATGGCC -3'

Sequencing Primer
(F):5'- CACTTGAACATTTGGGTGTTGAC -3'
(R):5'- CATGGCCTGGATTATTCTTTAAGAC -3'
Posted On 2018-03-15