Mutagenetix > Incidental Mutation

Incidental Mutation 'R6277:Ptprn2'

507739

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R6277 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116876180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 441 (D441G)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably benign
Transcript: ENSMUST00000070733
AA Change: D441G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: D441G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189009

Predicted Effect

probably benign
Transcript: ENSMUST00000190247
AA Change: D441G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: D441G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Meta Mutation Damage Score

0.0796

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.2%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,663,694	Y105H	possibly damaging	Het
4921539E11Rik	A	T	4: 103,231,471	Y179*	probably null	Het
Abca7	G	C	10: 80,006,158	V1042L	probably benign	Het
Adck5	C	A	15: 76,593,263	T99K	possibly damaging	Het
Adcy5	A	G	16: 35,289,526	T823A	probably benign	Het
Adra1d	G	T	2: 131,561,163	R336S	probably damaging	Het
Arhgap39	A	T	15: 76,735,137	M749K	probably damaging	Het
Arid4a	A	G	12: 71,039,891	R168G	possibly damaging	Het
Atxn10	A	G	15: 85,391,692	T317A	probably benign	Het
Bicc1	T	C	10: 71,027,901	K22E	possibly damaging	Het
Cacna1b	T	G	2: 24,730,796	T281P	probably damaging	Het
Ccdc174	A	T	6: 91,880,291	Q26L	probably damaging	Het
Celf3	T	C	3: 94,485,365	C124R	probably damaging	Het
Cfap44	A	G	16: 44,437,306	E1068G	probably benign	Het
Crybg1	T	A	10: 43,997,259	E1284D	probably benign	Het
Dcbld2	T	A	16: 58,451,756	Y392N	probably damaging	Het
Dcbld2	C	T	16: 58,465,503	P675L	probably damaging	Het
Dnah12	A	T	14: 26,770,482	H1193L	probably damaging	Het
Ern2	A	G	7: 122,186,107	F16L	probably benign	Het
Fam163b	G	T	2: 27,112,751	T78N	probably benign	Het
Fbxw21	A	T	9: 109,145,555	I299K	possibly damaging	Het
Foxg1	A	G	12: 49,385,516	N344S	probably benign	Het
Git2	A	G	5: 114,733,247	I202T	probably damaging	Het
Gm11595	G	T	11: 99,772,684	P57T	unknown	Het
Gm11639	G	C	11: 105,010,322	E4422D	possibly damaging	Het
Gm12258	G	A	11: 58,854,287	V15M	probably damaging	Het
Gm13119	A	G	4: 144,363,653	E421G	probably damaging	Het
Gm15056	C	T	8: 20,900,898	G40S	probably damaging	Het
Gm960	G	T	19: 4,627,222	S466*	probably null	Het
Gnal	C	A	18: 67,213,072	H274Q	probably damaging	Het
Hormad2	A	T	11: 4,421,583		probably null	Het
Ighv7-2	A	G	12: 113,912,467	I6T	probably benign	Het
Irf9	A	G	14: 55,607,652	D323G	probably benign	Het
Klhl23	G	T	2: 69,833,752	D482Y	probably damaging	Het
Lama4	A	G	10: 39,106,010	N1745S	probably damaging	Het
Lct	T	A	1: 128,304,237	Y625F	probably benign	Het
Lrrc26	T	C	2: 25,290,104	V39A	probably benign	Het
Mllt6	G	A	11: 97,673,948	A527T	probably damaging	Het
Mrgprb4	T	A	7: 48,198,901	D93V	probably benign	Het
Nlrp5	A	G	7: 23,421,455	D698G	probably damaging	Het
Olfr62	T	A	4: 118,666,323	S269T	probably benign	Het
Pacsin1	T	A	17: 27,705,995		probably null	Het
Padi3	A	T	4: 140,791,161		probably null	Het
Pcdha8	T	C	18: 36,994,358	I631T	probably damaging	Het
Pkn3	G	A	2: 30,082,945	G315D	possibly damaging	Het
Ppfibp1	T	A	6: 147,005,924	D228E	probably benign	Het
Prag1	G	T	8: 36,146,591	R1099L	probably damaging	Het
Prr36	A	G	8: 4,214,746		probably benign	Het
Prrc2c	A	G	1: 162,714,314	S369P	probably benign	Het
Slc9c1	G	A	16: 45,606,841		probably benign	Het
Slit1	G	A	19: 41,600,509	T1513I	possibly damaging	Het
Smcr8	C	T	11: 60,778,809	T261M	probably benign	Het
Spata17	G	A	1: 187,193,954	R60*	probably null	Het
Speer4f1	A	G	5: 17,476,243	R40G	probably damaging	Het
Spns3	A	G	11: 72,529,640	V340A	possibly damaging	Het
Srgap3	T	C	6: 112,739,383	I595V	probably benign	Het
Srms	G	A	2: 181,206,245	A489V	possibly damaging	Het
St3gal4	T	C	9: 35,053,262	N169S	probably damaging	Het
Taar5	T	A	10: 23,971,271	V189E	probably damaging	Het
Tbc1d32	G	A	10: 56,195,429	P333L	probably benign	Het
Tet3	G	T	6: 83,368,084	Y1790*	probably null	Het
Ticrr	T	A	7: 79,694,696	H1436Q	probably benign	Het
Ubl7	C	T	9: 57,923,272	L334F	possibly damaging	Het
Unc13a	A	G	8: 71,666,639		probably null	Het
Unc13c	T	C	9: 73,699,169	D1303G	probably damaging	Het
Vmn2r114	A	G	17: 23,290,980	L842P	possibly damaging	Het
Vps35	G	T	8: 85,261,228	Q765K	possibly damaging	Het
Zfp72	G	T	13: 74,372,524	S145*	probably null	Het
Zgrf1	C	T	3: 127,598,812	A1327V	possibly damaging	Het
Zkscan6	T	A	11: 65,828,157	S334R	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GTTAGGTCAACCGTCTGAGC -3'
(R):5'- AGAGCCACCACTCACTTGTTTC -3'

Sequencing Primer
(F):5'- GTCAACCGTCTGAGCTTCCAG -3'
(R):5'- ACTCACTTGTTTCCTGTGAGG -3'

Posted On

2018-03-15