Incidental Mutation 'R6277:Ptprn2'
ID 507739
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase, receptor type, N polypeptide 2
Synonyms phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock # R6277 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116485720-117276849 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116876180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 441 (D441G)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: D441G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: D441G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: D441G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: D441G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117269651 critical splice donor site probably null
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTTAGGTCAACCGTCTGAGC -3'
(R):5'- AGAGCCACCACTCACTTGTTTC -3'

Sequencing Primer
(F):5'- GTCAACCGTCTGAGCTTCCAG -3'
(R):5'- ACTCACTTGTTTCCTGTGAGG -3'
Posted On 2018-03-15