Incidental Mutation 'R6277:Zfp72'
ID507740
Institutional Source Beutler Lab
Gene Symbol Zfp72
Ensembl Gene ENSMUSG00000069184
Gene Namezinc finger protein 72
SynonymsZfp74
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6277 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74369326-74390836 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 74372524 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 145 (S145*)
Ref Sequence ENSEMBL: ENSMUSP00000152502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
Predicted Effect probably null
Transcript: ENSMUST00000091481
AA Change: S145*
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: S145*

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223163
AA Change: S145*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Zfp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Zfp72 UTSW 13 74372071 missense probably damaging 1.00
R0711:Zfp72 UTSW 13 74376425 splice site probably benign
R1498:Zfp72 UTSW 13 74372617 missense probably benign 0.01
R4032:Zfp72 UTSW 13 74372330 missense possibly damaging 0.62
R4629:Zfp72 UTSW 13 74372393 missense probably damaging 1.00
R6111:Zfp72 UTSW 13 74372385 missense probably benign 0.31
R6130:Zfp72 UTSW 13 74372341 missense possibly damaging 0.75
R6800:Zfp72 UTSW 13 74371961 missense probably benign 0.00
R6909:Zfp72 UTSW 13 74371742 missense possibly damaging 0.47
R7298:Zfp72 UTSW 13 74372394 missense possibly damaging 0.93
R7330:Zfp72 UTSW 13 74375034 missense probably damaging 0.99
R7341:Zfp72 UTSW 13 74372348 missense possibly damaging 0.68
RF014:Zfp72 UTSW 13 74375054 missense probably benign 0.17
Z1177:Zfp72 UTSW 13 74371792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCTGCATTTGTAGGGTTTCTC -3'
(R):5'- CCTACAAATGTGAACAATGTGGCA -3'

Sequencing Primer
(F):5'- AAACCATGGTAAAGGCTTTGC -3'
(R):5'- GTGAACAATGTGGCAAAGCTTTTAGC -3'
Posted On2018-03-15