Mutagenetix > Incidental Mutation

Incidental Mutation 'R6277:Vmn2r114'

507752

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r114

Ensembl Gene

ENSMUSG00000091945

Gene Name

vomeronasal 2, receptor 114

Synonyms

EG666002

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R6277 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23290934-23312313 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23290980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 842 (L842P)

Ref Sequence

ENSEMBL: ENSMUSP00000127505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168033]

AlphaFold

E9Q281

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168033
AA Change: L842P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: L842P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	470	1.5e-24	PFAM
Pfam:NCD3G	511	564	1.5e-18	PFAM
Pfam:7tm_3	597	832	1.4e-55	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.2%

Validation Efficiency

96% (70/73)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,663,694	Y105H	possibly damaging	Het
4921539E11Rik	A	T	4: 103,231,471	Y179*	probably null	Het
Abca7	G	C	10: 80,006,158	V1042L	probably benign	Het
Adck5	C	A	15: 76,593,263	T99K	possibly damaging	Het
Adcy5	A	G	16: 35,289,526	T823A	probably benign	Het
Adra1d	G	T	2: 131,561,163	R336S	probably damaging	Het
Arhgap39	A	T	15: 76,735,137	M749K	probably damaging	Het
Arid4a	A	G	12: 71,039,891	R168G	possibly damaging	Het
Atxn10	A	G	15: 85,391,692	T317A	probably benign	Het
Bicc1	T	C	10: 71,027,901	K22E	possibly damaging	Het
Cacna1b	T	G	2: 24,730,796	T281P	probably damaging	Het
Ccdc174	A	T	6: 91,880,291	Q26L	probably damaging	Het
Celf3	T	C	3: 94,485,365	C124R	probably damaging	Het
Cfap44	A	G	16: 44,437,306	E1068G	probably benign	Het
Crybg1	T	A	10: 43,997,259	E1284D	probably benign	Het
Dcbld2	T	A	16: 58,451,756	Y392N	probably damaging	Het
Dcbld2	C	T	16: 58,465,503	P675L	probably damaging	Het
Dnah12	A	T	14: 26,770,482	H1193L	probably damaging	Het
Ern2	A	G	7: 122,186,107	F16L	probably benign	Het
Fam163b	G	T	2: 27,112,751	T78N	probably benign	Het
Fbxw21	A	T	9: 109,145,555	I299K	possibly damaging	Het
Foxg1	A	G	12: 49,385,516	N344S	probably benign	Het
Git2	A	G	5: 114,733,247	I202T	probably damaging	Het
Gm11595	G	T	11: 99,772,684	P57T	unknown	Het
Gm11639	G	C	11: 105,010,322	E4422D	possibly damaging	Het
Gm12258	G	A	11: 58,854,287	V15M	probably damaging	Het
Gm13119	A	G	4: 144,363,653	E421G	probably damaging	Het
Gm15056	C	T	8: 20,900,898	G40S	probably damaging	Het
Gm960	G	T	19: 4,627,222	S466*	probably null	Het
Gnal	C	A	18: 67,213,072	H274Q	probably damaging	Het
Hormad2	A	T	11: 4,421,583		probably null	Het
Ighv7-2	A	G	12: 113,912,467	I6T	probably benign	Het
Irf9	A	G	14: 55,607,652	D323G	probably benign	Het
Klhl23	G	T	2: 69,833,752	D482Y	probably damaging	Het
Lama4	A	G	10: 39,106,010	N1745S	probably damaging	Het
Lct	T	A	1: 128,304,237	Y625F	probably benign	Het
Lrrc26	T	C	2: 25,290,104	V39A	probably benign	Het
Mllt6	G	A	11: 97,673,948	A527T	probably damaging	Het
Mrgprb4	T	A	7: 48,198,901	D93V	probably benign	Het
Nlrp5	A	G	7: 23,421,455	D698G	probably damaging	Het
Olfr62	T	A	4: 118,666,323	S269T	probably benign	Het
Pacsin1	T	A	17: 27,705,995		probably null	Het
Padi3	A	T	4: 140,791,161		probably null	Het
Pcdha8	T	C	18: 36,994,358	I631T	probably damaging	Het
Pkn3	G	A	2: 30,082,945	G315D	possibly damaging	Het
Ppfibp1	T	A	6: 147,005,924	D228E	probably benign	Het
Prag1	G	T	8: 36,146,591	R1099L	probably damaging	Het
Prr36	A	G	8: 4,214,746		probably benign	Het
Prrc2c	A	G	1: 162,714,314	S369P	probably benign	Het
Ptprn2	A	G	12: 116,876,180	D441G	probably benign	Het
Slc9c1	G	A	16: 45,606,841		probably benign	Het
Slit1	G	A	19: 41,600,509	T1513I	possibly damaging	Het
Smcr8	C	T	11: 60,778,809	T261M	probably benign	Het
Spata17	G	A	1: 187,193,954	R60*	probably null	Het
Speer4f1	A	G	5: 17,476,243	R40G	probably damaging	Het
Spns3	A	G	11: 72,529,640	V340A	possibly damaging	Het
Srgap3	T	C	6: 112,739,383	I595V	probably benign	Het
Srms	G	A	2: 181,206,245	A489V	possibly damaging	Het
St3gal4	T	C	9: 35,053,262	N169S	probably damaging	Het
Taar5	T	A	10: 23,971,271	V189E	probably damaging	Het
Tbc1d32	G	A	10: 56,195,429	P333L	probably benign	Het
Tet3	G	T	6: 83,368,084	Y1790*	probably null	Het
Ticrr	T	A	7: 79,694,696	H1436Q	probably benign	Het
Ubl7	C	T	9: 57,923,272	L334F	possibly damaging	Het
Unc13a	A	G	8: 71,666,639		probably null	Het
Unc13c	T	C	9: 73,699,169	D1303G	probably damaging	Het
Vps35	G	T	8: 85,261,228	Q765K	possibly damaging	Het
Zfp72	G	T	13: 74,372,524	S145*	probably null	Het
Zgrf1	C	T	3: 127,598,812	A1327V	possibly damaging	Het
Zkscan6	T	A	11: 65,828,157	S334R	probably benign	Het

Other mutations in Vmn2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Vmn2r114	APN	17	23291665	missense	probably damaging	1.00
IGL00990:Vmn2r114	APN	17	23290965	missense	probably benign
IGL00990:Vmn2r114	APN	17	23290983	missense	probably benign	0.23
IGL00990:Vmn2r114	APN	17	23291238	missense	probably damaging	1.00
IGL01838:Vmn2r114	APN	17	23296982	missense	probably benign	0.44
IGL01990:Vmn2r114	APN	17	23310381	missense	probably benign	0.22
IGL01994:Vmn2r114	APN	17	23310477	missense	probably damaging	1.00
IGL02153:Vmn2r114	APN	17	23291808	missense	probably benign	0.01
IGL02453:Vmn2r114	APN	17	23311134	missense	probably benign	0.00
IGL02621:Vmn2r114	APN	17	23310520	missense	probably damaging	0.98
IGL02938:Vmn2r114	APN	17	23291289	missense	probably benign	0.10
IGL03130:Vmn2r114	APN	17	23296996	splice site	probably benign
IGL03325:Vmn2r114	APN	17	23291678	missense	probably damaging	1.00
BB004:Vmn2r114	UTSW	17	23291645	missense	probably damaging	1.00
R0109:Vmn2r114	UTSW	17	23310575	nonsense	probably null
R0164:Vmn2r114	UTSW	17	23309826	critical splice donor site	probably null
R0310:Vmn2r114	UTSW	17	23290943	missense	probably benign	0.23
R0583:Vmn2r114	UTSW	17	23290932	makesense	probably null
R0677:Vmn2r114	UTSW	17	23310594	missense	probably damaging	1.00
R1127:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1157:Vmn2r114	UTSW	17	23310340	missense	possibly damaging	0.60
R1323:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1347:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1435:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1437:Vmn2r114	UTSW	17	23291211	missense	probably damaging	1.00
R1585:Vmn2r114	UTSW	17	23291701	missense	probably damaging	0.98
R1641:Vmn2r114	UTSW	17	23296988	missense	probably benign	0.00
R1748:Vmn2r114	UTSW	17	23308061	missense	probably benign	0.17
R1954:Vmn2r114	UTSW	17	23311112	missense	probably benign	0.32
R2081:Vmn2r114	UTSW	17	23291109	missense	possibly damaging	0.91
R2103:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2113:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2134:Vmn2r114	UTSW	17	23291763	missense	probably damaging	1.00
R2149:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2424:Vmn2r114	UTSW	17	23296868	missense	possibly damaging	0.90
R2847:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2848:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2893:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3017:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3018:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3019:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3020:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3021:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4628:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4668:Vmn2r114	UTSW	17	23310473	missense	possibly damaging	0.83
R4840:Vmn2r114	UTSW	17	23291379	missense	probably damaging	0.97
R4841:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4842:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4856:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4886:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4992:Vmn2r114	UTSW	17	23291791	missense	probably benign	0.03
R5182:Vmn2r114	UTSW	17	23291658	missense	probably damaging	0.96
R5223:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5405:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5449:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5615:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5834:Vmn2r114	UTSW	17	23310625	missense	possibly damaging	0.90
R6150:Vmn2r114	UTSW	17	23291295	missense	probably benign	0.03
R6403:Vmn2r114	UTSW	17	23309965	missense	probably damaging	0.99
R6589:Vmn2r114	UTSW	17	23291668	missense	probably damaging	1.00
R6613:Vmn2r114	UTSW	17	23310246	missense	possibly damaging	0.82
R6747:Vmn2r114	UTSW	17	23309876	missense	probably benign	0.00
R6837:Vmn2r114	UTSW	17	23310202	missense	probably benign	0.10
R6911:Vmn2r114	UTSW	17	23291130	missense	probably damaging	0.98
R6950:Vmn2r114	UTSW	17	23310163	missense	probably benign	0.03
R7276:Vmn2r114	UTSW	17	23290960	missense	probably damaging	0.97
R7482:Vmn2r114	UTSW	17	23291494	missense	probably damaging	1.00
R7514:Vmn2r114	UTSW	17	23308061	missense	probably null	0.96
R7523:Vmn2r114	UTSW	17	23310637	missense	probably benign	0.01
R7563:Vmn2r114	UTSW	17	23291026	missense	probably benign	0.01
R7585:Vmn2r114	UTSW	17	23291265	missense	probably damaging	1.00
R7593:Vmn2r114	UTSW	17	23291843	nonsense	probably null
R7611:Vmn2r114	UTSW	17	23296970	missense	probably damaging	0.97
R7641:Vmn2r114	UTSW	17	23308203	missense	possibly damaging	0.53
R7651:Vmn2r114	UTSW	17	23291012	nonsense	probably null
R7970:Vmn2r114	UTSW	17	23311212	missense	probably benign	0.00
R8737:Vmn2r114	UTSW	17	23310168	missense	probably benign	0.36
R8802:Vmn2r114	UTSW	17	23309862	missense	possibly damaging	0.65
R8847:Vmn2r114	UTSW	17	23310012	missense	probably damaging	1.00
R8991:Vmn2r114	UTSW	17	23310312	missense	probably damaging	1.00
R9138:Vmn2r114	UTSW	17	23291604	missense	probably damaging	1.00
R9173:Vmn2r114	UTSW	17	23291553	missense	probably damaging	0.99
R9175:Vmn2r114	UTSW	17	23308238	missense	probably damaging	1.00
R9657:Vmn2r114	UTSW	17	23291716	missense	probably damaging	1.00
R9670:Vmn2r114	UTSW	17	23312124	missense
X0065:Vmn2r114	UTSW	17	23310957	missense	probably benign	0.34
Z1088:Vmn2r114	UTSW	17	23290932	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TTAGTAGATAGGTATTGCCAGGC -3'
(R):5'- TCTGGGATACTTGGCTACCC -3'

Sequencing Primer
(F):5'- GCCAGGCAATATTCTTAGTGGAAAC -3'
(R):5'- CCATAACATTCAGCATGCTGGTG -3'

Posted On

2018-03-15