Incidental Mutation 'R6278:Tmcc2'
ID 507758
Institutional Source Beutler Lab
Gene Symbol Tmcc2
Ensembl Gene ENSMUSG00000042066
Gene Name transmembrane and coiled-coil domains 2
Synonyms 1110063G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R6278 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 132356315-132391281 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132358982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 577 (M577K)
Ref Sequence ENSEMBL: ENSMUSP00000038369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045473] [ENSMUST00000132435] [ENSMUST00000142609]
AlphaFold Q80W04
Predicted Effect probably damaging
Transcript: ENSMUST00000045473
AA Change: M577K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038369
Gene: ENSMUSG00000042066
AA Change: M577K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 164 183 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
Pfam:Tmemb_cc2 283 694 6.3e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125439
Predicted Effect probably damaging
Transcript: ENSMUST00000132435
AA Change: M499K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118844
Gene: ENSMUSG00000042066
AA Change: M499K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 86 105 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
Pfam:Tmemb_cc2 203 617 1.1e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138717
Predicted Effect possibly damaging
Transcript: ENSMUST00000142609
AA Change: M342K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115721
Gene: ENSMUSG00000042066
AA Change: M342K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Tmemb_cc2 46 460 2.2e-194 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Tmcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Tmcc2 APN 1 132380698 missense probably benign
IGL01991:Tmcc2 APN 1 132361092 missense probably benign 0.25
IGL02259:Tmcc2 APN 1 132361160 missense probably benign
IGL02310:Tmcc2 APN 1 132358907 missense probably damaging 1.00
IGL02551:Tmcc2 APN 1 132357579 missense probably damaging 1.00
IGL03301:Tmcc2 APN 1 132360819 missense possibly damaging 0.95
IGL03347:Tmcc2 APN 1 132357652 missense probably damaging 1.00
R0131:Tmcc2 UTSW 1 132380706 missense probably benign 0.10
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1538:Tmcc2 UTSW 1 132380980 missense probably damaging 0.98
R2428:Tmcc2 UTSW 1 132360831 missense probably damaging 1.00
R3907:Tmcc2 UTSW 1 132360638 missense probably damaging 1.00
R4890:Tmcc2 UTSW 1 132380779 missense probably benign 0.43
R5364:Tmcc2 UTSW 1 132357796 missense probably damaging 1.00
R5567:Tmcc2 UTSW 1 132357805 missense probably benign 0.01
R5596:Tmcc2 UTSW 1 132360483 missense probably damaging 1.00
R5916:Tmcc2 UTSW 1 132357691 missense probably damaging 0.98
R5931:Tmcc2 UTSW 1 132357755 small deletion probably benign
R7404:Tmcc2 UTSW 1 132361021 missense probably damaging 0.98
R7806:Tmcc2 UTSW 1 132360789 missense probably damaging 1.00
R7848:Tmcc2 UTSW 1 132360621 missense probably damaging 1.00
R7903:Tmcc2 UTSW 1 132360461 missense probably benign 0.00
R9458:Tmcc2 UTSW 1 132359009 missense probably damaging 1.00
RF012:Tmcc2 UTSW 1 132361018 missense probably damaging 1.00
X0052:Tmcc2 UTSW 1 132360333 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAATTGGCCCCATGGAT -3'
(R):5'- GCGGGACTGGACACATGG -3'

Sequencing Primer
(F):5'- AATTGGCCCCATGGATATGTTTC -3'
(R):5'- CACATGGGTGGGCTGCATG -3'
Posted On 2018-03-15