Incidental Mutation 'R6278:Olfr1137'
ID507762
Institutional Source Beutler Lab
Gene Symbol Olfr1137
Ensembl Gene ENSMUSG00000075150
Gene Nameolfactory receptor 1137
SynonymsGA_x6K02T2Q125-49215724-49214792, MOR40-9P, MOR177-20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87708873-87713179 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 87711471 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 145 (L145*)
Ref Sequence ENSEMBL: ENSMUSP00000149311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099850] [ENSMUST00000214209]
Predicted Effect probably null
Transcript: ENSMUST00000099850
AA Change: L145*
SMART Domains Protein: ENSMUSP00000097437
Gene: ENSMUSG00000075150
AA Change: L145*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 2.8e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214209
AA Change: L145*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Olfr1137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr1137 APN 2 87711133 missense possibly damaging 0.76
IGL02225:Olfr1137 APN 2 87711399 missense possibly damaging 0.78
IGL02312:Olfr1137 APN 2 87711009 missense probably benign 0.00
IGL03326:Olfr1137 APN 2 87711695 missense probably damaging 1.00
R0432:Olfr1137 UTSW 2 87711430 missense probably benign 0.13
R1656:Olfr1137 UTSW 2 87711078 missense possibly damaging 0.94
R1852:Olfr1137 UTSW 2 87710973 splice site probably null
R1880:Olfr1137 UTSW 2 87711295 missense probably damaging 1.00
R2184:Olfr1137 UTSW 2 87711205 missense probably damaging 1.00
R2511:Olfr1137 UTSW 2 87711048 missense probably damaging 1.00
R4356:Olfr1137 UTSW 2 87711885 missense possibly damaging 0.95
R6184:Olfr1137 UTSW 2 87711844 missense probably benign
R6621:Olfr1137 UTSW 2 87711555 missense probably benign 0.10
R7549:Olfr1137 UTSW 2 87711771 missense probably damaging 1.00
R7799:Olfr1137 UTSW 2 87711084 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GACACTTGAGATTGTGCTCAGTTC -3'
(R):5'- TGCTGGTAGACCTAGTAGCC -3'

Sequencing Primer
(F):5'- TGTGCTCAGTTCAATGAAACC -3'
(R):5'- GTAGACCTAGTAGCCGAGAAACATTC -3'
Posted On2018-03-15