Incidental Mutation 'R6278:Gm13128'
ID507769
Institutional Source Beutler Lab
Gene Symbol Gm13128
Ensembl Gene ENSMUSG00000078508
Gene Namepredicted gene 13128
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144330249-144333465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144330267 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 7 (P7S)
Ref Sequence ENSEMBL: ENSMUSP00000101377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105751]
Predicted Effect probably damaging
Transcript: ENSMUST00000105751
AA Change: P7S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101377
Gene: ENSMUSG00000078508
AA Change: P7S

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 6e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Gm13128
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Gm13128 UTSW 4 144331287 missense probably benign 0.01
R1743:Gm13128 UTSW 4 144333005 missense probably benign 0.03
R3079:Gm13128 UTSW 4 144331528 missense probably damaging 1.00
R3948:Gm13128 UTSW 4 144331306 missense probably benign 0.01
R3954:Gm13128 UTSW 4 144331668 missense probably benign 0.03
R4448:Gm13128 UTSW 4 144332685 missense probably damaging 1.00
R5008:Gm13128 UTSW 4 144331266 missense probably benign 0.02
R5715:Gm13128 UTSW 4 144331300 missense possibly damaging 0.67
R5986:Gm13128 UTSW 4 144332753 missense probably damaging 0.98
R6008:Gm13128 UTSW 4 144331207 missense probably benign 0.08
R6383:Gm13128 UTSW 4 144333147 makesense probably null
R6523:Gm13128 UTSW 4 144331648 missense probably benign 0.42
R6747:Gm13128 UTSW 4 144332978 missense probably benign 0.00
R7276:Gm13128 UTSW 4 144332646 missense possibly damaging 0.67
R7555:Gm13128 UTSW 4 144332741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTTTGCTTTTGAGACCAC -3'
(R):5'- ACTCCCTCCAGTATAGCCTG -3'

Sequencing Primer
(F):5'- GCTTTTGAGACCACCAAATAGTGAG -3'
(R):5'- CAGTATAGCCTGGAAAGTCTCC -3'
Posted On2018-03-15