Incidental Mutation 'R6278:Acsm3'
ID507778
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Nameacyl-CoA synthetase medium-chain family member 3
SynonymsSah, Sa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119760923-119787513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119773849 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 192 (S192P)
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529]
Predicted Effect probably damaging
Transcript: ENSMUST00000063770
AA Change: S192P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935
AA Change: S192P

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106526
AA Change: S192P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935
AA Change: S192P

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106527
AA Change: S192P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935
AA Change: S192P

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106528
AA Change: S192P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935
AA Change: S192P

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106529
AA Change: S192P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935
AA Change: S192P

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149766
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0422:Acsm3 UTSW 7 119773740 nonsense probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R4386:Acsm3 UTSW 7 119773871 missense probably damaging 1.00
R5437:Acsm3 UTSW 7 119778497 intron probably benign
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 unclassified probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
R7381:Acsm3 UTSW 7 119780826 missense probably damaging 0.98
R7396:Acsm3 UTSW 7 119773829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCTATCATAGAAGTTACCCTTGC -3'
(R):5'- TGCACTGCCAACTGTTAGTTC -3'

Sequencing Primer
(F):5'- TTTCTTTTCTATTCCTCTAGGGACAG -3'
(R):5'- GCACTGCCAACTGTTAGTTCTGTAAC -3'
Posted On2018-03-15