Incidental Mutation 'R6279:Slc19a2'
ID507813
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164256775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 78 (T78M)
Ref Sequence ENSEMBL: ENSMUSP00000123870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably damaging
Transcript: ENSMUST00000044021
AA Change: T78M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: T78M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159230
AA Change: T78M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: T78M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169394
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Cyp2d22 C A 15: 82,373,968 K150N probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il12a A T 3: 68,697,979 I193F probably damaging Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGGCTACTCCAGGAGTTACC -3'
(R):5'- GTGACTTTCTGGTACATGCCC -3'

Sequencing Primer
(F):5'- AGTTACCTGAACTTACTGTGGCCAG -3'
(R):5'- CAGGTCCACCACAGTATAGATATAGG -3'
Posted On2018-03-15