Incidental Mutation 'R6279:Il12a'
ID507817
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Nameinterleukin 12a
SynonymsIL-12p35, p35
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location68690644-68698547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68697979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
Predicted Effect probably damaging
Transcript: ENSMUST00000029345
AA Change: I214F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: I214F

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107816
AA Change: I193F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: I193F

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195517
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Cyp2d22 C A 15: 82,373,968 K150N probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68691555 missense possibly damaging 0.96
IGL01820:Il12a APN 3 68692162 splice site probably benign
IGL01989:Il12a APN 3 68691576 splice site probably benign
bakers_dozen UTSW 3 68697987 frame shift probably null
R0388:Il12a UTSW 3 68695187 splice site probably null
R0646:Il12a UTSW 3 68697890 splice site probably benign
R1083:Il12a UTSW 3 68695333 missense probably damaging 1.00
R1588:Il12a UTSW 3 68695563 missense probably benign 0.04
R2240:Il12a UTSW 3 68694184 nonsense probably null
R2909:Il12a UTSW 3 68697987 frame shift probably null
R2925:Il12a UTSW 3 68697987 frame shift probably null
R3696:Il12a UTSW 3 68697987 frame shift probably null
R3697:Il12a UTSW 3 68697987 frame shift probably null
R3698:Il12a UTSW 3 68697987 frame shift probably null
R4332:Il12a UTSW 3 68695261 intron probably benign
R5809:Il12a UTSW 3 68695262 intron probably benign
R6305:Il12a UTSW 3 68694178 missense possibly damaging 0.80
R6847:Il12a UTSW 3 68695566 missense probably damaging 1.00
R7751:Il12a UTSW 3 68697902 missense probably damaging 1.00
R8188:Il12a UTSW 3 68691539 missense unknown
RF003:Il12a UTSW 3 68695229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGACTTTGCATTGACTGTC -3'
(R):5'- AGGTAGCTGTGCCACCTTTG -3'

Sequencing Primer
(F):5'- GACTGTCTCCCATTTTGCAGACAAAC -3'
(R):5'- ATTCCTGAAGGAGCTTAAGGCCC -3'
Posted On2018-03-15