Incidental Mutation 'R6279:Vwa3a'
ID507831
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Namevon Willebrand factor A domain containing 3A
SynonymsE030013G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120739318-120805742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120782400 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3 (N3S)
Ref Sequence ENSEMBL: ENSMUSP00000129672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000165055] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168430] [ENSMUST00000168600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033180
AA Change: N543S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: N543S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165055
AA Change: N3S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129672
Gene: ENSMUSG00000030889
AA Change: N3S

DomainStartEndE-ValueType
Blast:VWA 1 162 1e-94 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166083
Predicted Effect possibly damaging
Transcript: ENSMUST00000166668
AA Change: N543S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: N543S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167213
AA Change: N543S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: N543S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168430
Predicted Effect possibly damaging
Transcript: ENSMUST00000168600
AA Change: N543S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: N543S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207721
Meta Mutation Damage Score 0.6964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Cyp2d22 C A 15: 82,373,968 K150N probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il12a A T 3: 68,697,979 I193F probably damaging Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
PIT4812001:Vwa3a UTSW 7 120776133 missense probably damaging 1.00
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R2408:Vwa3a UTSW 7 120773294 missense probably benign 0.00
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120762423 missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
R7135:Vwa3a UTSW 7 120773030 missense possibly damaging 0.69
R7215:Vwa3a UTSW 7 120795630 missense possibly damaging 0.83
R7282:Vwa3a UTSW 7 120786465 missense probably benign 0.03
R7351:Vwa3a UTSW 7 120776336 missense probably damaging 0.99
R7406:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R7557:Vwa3a UTSW 7 120795618 missense possibly damaging 0.90
R7612:Vwa3a UTSW 7 120752615 missense probably null 0.47
R7699:Vwa3a UTSW 7 120752618 missense probably damaging 1.00
R7823:Vwa3a UTSW 7 120772962 missense probably damaging 1.00
R8074:Vwa3a UTSW 7 120799098 missense probably benign 0.00
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Z1177:Vwa3a UTSW 7 120759133 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGGAGTTGGCTTTAATGCG -3'
(R):5'- ATAAGACTTGTGAGGGCCAC -3'

Sequencing Primer
(F):5'- GCGTTATGACCAGAAAACCTTGTGAC -3'
(R):5'- GGCCACATTTGAGACCCTGAAG -3'
Posted On2018-03-15