Incidental Mutation 'R6279:Exph5'
ID 507837
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 044449-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6279 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53285246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 776 (T776A)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect possibly damaging
Transcript: ENSMUST00000051014
AA Change: T776A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: T776A

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132410
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap1s3 T C 1: 79,602,840 (GRCm39) K56E probably damaging Het
Apob C T 12: 8,057,769 (GRCm39) R2084* probably null Het
Arid1b C A 17: 5,392,274 (GRCm39) L1935M probably damaging Het
Bag6 T C 17: 35,357,577 (GRCm39) V122A probably damaging Het
Bmal2 A G 6: 146,723,444 (GRCm39) Y258C probably damaging Het
Cacna1e T A 1: 154,301,678 (GRCm39) T1685S probably benign Het
Cd163 T A 6: 124,294,950 (GRCm39) C671* probably null Het
Cul3 A G 1: 80,264,669 (GRCm39) V211A probably damaging Het
Cyp2d22 C A 15: 82,258,169 (GRCm39) K150N probably damaging Het
Dnah6 A T 6: 73,042,798 (GRCm39) I3208N probably damaging Het
Dnah7b T C 1: 46,365,046 (GRCm39) F3609S probably damaging Het
Endod1 T C 9: 14,268,166 (GRCm39) T440A probably benign Het
Faap24 A C 7: 35,095,709 (GRCm39) V12G possibly damaging Het
Gabrg2 T C 11: 41,891,350 (GRCm39) probably null Het
Ggta1 A G 2: 35,298,006 (GRCm39) Y148H probably damaging Het
Hspe1 T A 1: 55,129,860 (GRCm39) probably null Het
Il12a A T 3: 68,605,312 (GRCm39) I193F probably damaging Het
Il2rb T C 15: 78,365,738 (GRCm39) N520D possibly damaging Het
Kat6a A G 8: 23,429,628 (GRCm39) Q1661R unknown Het
Klhl18 T A 9: 110,265,130 (GRCm39) N362I probably benign Het
Lrba A G 3: 86,256,171 (GRCm39) D1171G probably benign Het
Mef2b C T 8: 70,619,769 (GRCm39) T285I possibly damaging Het
Mmrn2 T C 14: 34,119,614 (GRCm39) S198P probably benign Het
Msh6 T C 17: 88,287,677 (GRCm39) W106R probably damaging Het
Nek5 T A 8: 22,597,737 (GRCm39) M281L probably benign Het
Or10w3 A G 19: 13,704,029 (GRCm39) I135V probably benign Het
Or2y15 T A 11: 49,351,039 (GRCm39) C178S probably damaging Het
Or4c105 A T 2: 88,647,719 (GRCm39) D68V probably damaging Het
Or52e19 A T 7: 102,959,636 (GRCm39) H236L probably benign Het
Or52e7 G A 7: 104,684,878 (GRCm39) V158M probably benign Het
Pcdhgb5 T A 18: 37,865,752 (GRCm39) F516I probably damaging Het
Pde10a T C 17: 9,197,789 (GRCm39) I1026T probably damaging Het
Pde4dip A C 3: 97,606,496 (GRCm39) L2126R probably damaging Het
Pds5b T A 5: 150,646,713 (GRCm39) N167K possibly damaging Het
Pkmyt1 C T 17: 23,951,476 (GRCm39) P10L probably benign Het
Pphln1-ps1 T C 16: 13,495,134 (GRCm39) S78P probably damaging Het
Prr5l A T 2: 101,547,765 (GRCm39) Y253* probably null Het
Rdh9 A G 10: 127,612,627 (GRCm39) T92A probably benign Het
Reln A G 5: 22,101,839 (GRCm39) Y3364H probably damaging Het
Rufy4 T A 1: 74,172,383 (GRCm39) S369T probably benign Het
Ryr1 A T 7: 28,786,853 (GRCm39) M1587K possibly damaging Het
Ryr2 T A 13: 11,695,885 (GRCm39) H2994L probably damaging Het
Safb2 T C 17: 56,870,226 (GRCm39) H950R possibly damaging Het
Sez6 T C 11: 77,867,367 (GRCm39) V788A possibly damaging Het
Sfrp4 G A 13: 19,808,023 (GRCm39) A141T probably damaging Het
Sh3d19 A T 3: 86,011,409 (GRCm39) I332F possibly damaging Het
Skor1 A T 9: 63,052,596 (GRCm39) W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Slc19a2 C T 1: 164,084,344 (GRCm39) T78M probably damaging Het
Slc8a3 T A 12: 81,361,752 (GRCm39) I356F probably damaging Het
Slk A G 19: 47,630,443 (GRCm39) T1205A probably damaging Het
Tcte1 T C 17: 45,844,215 (GRCm39) S64P possibly damaging Het
Tnpo1 G A 13: 99,027,216 (GRCm39) P25L possibly damaging Het
Top3a T C 11: 60,640,234 (GRCm39) D488G probably benign Het
Tshz1 A T 18: 84,033,436 (GRCm39) V324D probably damaging Het
Ttc21a T C 9: 119,790,905 (GRCm39) S884P possibly damaging Het
Usp17lb A G 7: 104,489,898 (GRCm39) L342P probably damaging Het
Vwa3a A G 7: 120,381,623 (GRCm39) N3S probably damaging Het
Zfp672 A T 11: 58,208,094 (GRCm39) C76S probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTCTCTTACTGACACCCAGC -3'
(R):5'- ACTCAAAGCACCAATGGCTG -3'

Sequencing Primer
(F):5'- AGGCCAACTGGGTTACCC -3'
(R):5'- AGCACCAATGGCTGTTTTTAATGG -3'
Posted On 2018-03-15