Incidental Mutation 'R6279:Ttc21a'
ID507840
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119961839 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 884 (S884P)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035100
AA Change: S884P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: S884P

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161967
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Cyp2d22 C A 15: 82,373,968 K150N probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il12a A T 3: 68,697,979 I193F probably damaging Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119954562 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 splice site probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119952254 missense probably benign 0.02
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4232:Ttc21a UTSW 9 119942618 missense probably benign 0.00
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119959037 missense probably benign
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
R8076:Ttc21a UTSW 9 119966326 missense probably benign 0.01
R8217:Ttc21a UTSW 9 119954628 missense probably benign 0.00
RF004:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119942680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAGGCACCCTTTCTGAC -3'
(R):5'- ACACCTGCAGCTTCTCAGAG -3'

Sequencing Primer
(F):5'- ACCCTTTCTGACCCTGCCAG -3'
(R):5'- TCCAACTTCCAAAGGCTGAGGTG -3'
Posted On2018-03-15