Incidental Mutation 'R6279:Slc8a3'
ID507848
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81314978 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 356 (I356F)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
Predicted Effect probably damaging
Transcript: ENSMUST00000064594
AA Change: I356F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: I356F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: I356F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: I356F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: I356F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: I356F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183102
Meta Mutation Damage Score 0.5516 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Cyp2d22 C A 15: 82,373,968 K150N probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il12a A T 3: 68,697,979 I193F probably damaging Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTCCACGTACATGGTCTTGG -3'
(R):5'- GGGAACTTTACACCTTTGGAAG -3'

Sequencing Primer
(F):5'- CCACGTACATGGTCTTGGATATATC -3'
(R):5'- GGAAAGGAGGTAGATGAATCTCGC -3'
Posted On2018-03-15