Incidental Mutation 'R6279:Cyp2d22'
ID507854
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms2D22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6279 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82370527-82380260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82373968 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 150 (K150N)
Ref Sequence ENSEMBL: ENSMUSP00000023083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
Predicted Effect probably damaging
Transcript: ENSMUST00000023083
AA Change: K150N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: K150N

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Meta Mutation Damage Score 0.3048 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,270 S78P probably damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Arid1b C A 17: 5,341,999 L1935M probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Faap24 A C 7: 35,396,284 V12G possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Ggta1 A G 2: 35,407,994 Y148H probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il12a A T 3: 68,697,979 I193F probably damaging Het
Il2rb T C 15: 78,481,538 N520D possibly damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
Lrba A G 3: 86,348,864 D1171G probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Msh6 T C 17: 87,980,249 W106R probably damaging Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1202 A T 2: 88,817,375 D68V probably damaging Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr1493-ps1 A G 19: 13,726,665 I135V probably benign Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pde10a T C 17: 8,978,957 I1026T probably damaging Het
Pde4dip A C 3: 97,699,180 L2126R probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pkmyt1 C T 17: 23,732,502 P10L probably benign Het
Prr5l A T 2: 101,717,420 Y253* probably null Het
Rdh9 A G 10: 127,776,758 T92A probably benign Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr1 A T 7: 29,087,428 M1587K possibly damaging Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Sh3d19 A T 3: 86,104,102 I332F possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Slk A G 19: 47,642,004 T1205A probably damaging Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Tnpo1 G A 13: 98,890,708 P25L possibly damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Tshz1 A T 18: 84,015,311 V324D probably damaging Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82371668 missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82374369 missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82372845 missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82373241 missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82371668 missense probably damaging 1.00
R0165:Cyp2d22 UTSW 15 82373280 missense probably benign 0.06
R0294:Cyp2d22 UTSW 15 82374445 missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82372508 missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82371936 missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82373978 missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82373172 missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82375827 missense probably benign 0.11
R4492:Cyp2d22 UTSW 15 82374370 missense probably benign 0.00
R4575:Cyp2d22 UTSW 15 82371932 missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R5344:Cyp2d22 UTSW 15 82371638 missense possibly damaging 0.95
R5523:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82373813 missense probably benign
R6060:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82371905 missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82373835 critical splice acceptor site probably null
R6563:Cyp2d22 UTSW 15 82371912 missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82375852 missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82374411 missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R8094:Cyp2d22 UTSW 15 82374355 missense probably benign 0.19
R8302:Cyp2d22 UTSW 15 82371820 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTCATCGTACTCAAAGCG -3'
(R):5'- ACAGTAGTGATGGGCTGTAGTC -3'

Sequencing Primer
(F):5'- GTTACACACTGCTTTGTCCAATAGGG -3'
(R):5'- GGCTGTAGTCATGGTAAAGTAGC -3'
Posted On2018-03-15