Incidental Mutation 'R6280:Spint1'
ID507874
Institutional Source Beutler Lab
Gene Symbol Spint1
Ensembl Gene ENSMUSG00000027315
Gene Nameserine protease inhibitor, Kunitz type 1
SynonymsHAI-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6280 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119237362-119249527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119245278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 194 (V194E)
Ref Sequence ENSEMBL: ENSMUSP00000106441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028783] [ENSMUST00000110816] [ENSMUST00000110817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028783
AA Change: V194E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028783
Gene: ENSMUSG00000027315
AA Change: V194E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110816
AA Change: V194E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106440
Gene: ENSMUSG00000027315
AA Change: V194E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110817
AA Change: V194E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106441
Gene: ENSMUSG00000027315
AA Change: V194E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139903
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kunitz family of serine protease inhibitors. The protein is a potent inhibitor specific for HGF activator and is thought to be involved in the regulation of the proteolytic activation of HGF in injured tissues. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality at E10.5 or earlier, growth retardation, and widespread cell apoptosis. Placental development is impaired with abnormalities in branching morphogenesis, the formation of the labyrinth layer and placental function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Spint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Spint1 APN 2 119246455 missense probably damaging 1.00
IGL02065:Spint1 APN 2 119238217 missense probably benign 0.02
R0206:Spint1 UTSW 2 119248345 splice site probably benign
R0208:Spint1 UTSW 2 119248345 splice site probably benign
R0415:Spint1 UTSW 2 119245615 missense probably damaging 1.00
R0691:Spint1 UTSW 2 119246467 missense probably damaging 1.00
R1236:Spint1 UTSW 2 119245573 missense probably benign 0.05
R2190:Spint1 UTSW 2 119238180 missense probably benign 0.01
R3890:Spint1 UTSW 2 119248802 missense probably benign 0.28
R4599:Spint1 UTSW 2 119246460 missense probably damaging 1.00
S24628:Spint1 UTSW 2 119245615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTCGTCTCGTTTACGG -3'
(R):5'- GTTTTCTCTATACACGACACTGGTC -3'

Sequencing Primer
(F):5'- ACTCGTCTCGTTTACGGTTAATTC -3'
(R):5'- ACACTGGTCATGAAGCCTG -3'
Posted On2018-03-15