Incidental Mutation 'R6280:Apbb2'
ID507889
Institutional Source Beutler Lab
Gene Symbol Apbb2
Ensembl Gene ENSMUSG00000029207
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 2
SynonymsTR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6280 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location66298703-66618784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66364982 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 443 (W443R)
Ref Sequence ENSEMBL: ENSMUSP00000125116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087256] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160063] [ENSMUST00000160870] [ENSMUST00000162349] [ENSMUST00000162366]
Predicted Effect probably damaging
Transcript: ENSMUST00000087256
AA Change: W464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: W464R

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159512
AA Change: W444R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: W444R

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159786
AA Change: W443R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: W443R

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160063
AA Change: W465R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207
AA Change: W465R

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160870
AA Change: W464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: W464R

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162349
AA Change: W464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: W464R

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162366
AA Change: W443R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: W443R

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201776
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Apbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
bund UTSW 5 66400255 missense probably damaging 1.00
Dionysis UTSW 5 66452250 missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0564:Apbb2 UTSW 5 66452250 missense probably damaging 0.99
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66311072 missense probably damaging 0.97
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
R7091:Apbb2 UTSW 5 66313334 missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66451603 missense probably damaging 1.00
R8026:Apbb2 UTSW 5 66451644 missense probably benign 0.00
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGAACTCATTTAGCCACTGAG -3'
(R):5'- GCCCATGAGTCACATTTCTGC -3'

Sequencing Primer
(F):5'- GGAACTCATTTAGCCACTGAGAAATG -3'
(R):5'- ATGAGTCACATTTCTGCCTCCTG -3'
Posted On2018-03-15