Incidental Mutation 'R6280:Kdm2b'
ID507893
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Namelysine (K)-specific demethylase 2B
SynonymsJhdm1b, Fbxl10, Cxxc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6280 (G1)
Quality Score158.009
Status Validated
Chromosome5
Chromosomal Location122870665-122989823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122878624 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1149 (N1149D)
Ref Sequence ENSEMBL: ENSMUSP00000114052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031435] [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000152872]
Predicted Effect probably damaging
Transcript: ENSMUST00000031435
AA Change: N654D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031435
Gene: ENSMUSG00000029475
AA Change: N654D

DomainStartEndE-ValueType
Pfam:zf-CXXC 45 91 1.6e-17 PFAM
PHD 101 163 8.58e-4 SMART
low complexity region 259 290 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
FBOX 505 545 1.69e-2 SMART
LRR 588 610 1.31e2 SMART
LRR 612 637 2.9e2 SMART
LRR 652 676 2.04e2 SMART
LRR 677 702 1.1e1 SMART
LRR 732 757 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046073
AA Change: N1187D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: N1187D

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086200
AA Change: N1181D

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: N1181D

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118027
AA Change: N1149D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: N1149D

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121739
AA Change: N1132D

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: N1132D

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139674
Predicted Effect probably benign
Transcript: ENSMUST00000152872
SMART Domains Protein: ENSMUSP00000119746
Gene: ENSMUSG00000029475

DomainStartEndE-ValueType
PHD 25 87 8.58e-4 SMART
low complexity region 243 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174357
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 122961567 missense probably damaging 1.00
IGL02061:Kdm2b APN 5 122883341 missense probably damaging 1.00
IGL02142:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02143:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02147:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02294:Kdm2b APN 5 122961474 missense probably damaging 1.00
IGL02309:Kdm2b APN 5 122947820 missense probably damaging 0.99
IGL03039:Kdm2b APN 5 122881671 missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 122932674 missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 122941047 missense probably damaging 1.00
R0008:Kdm2b UTSW 5 122881743 missense probably benign 0.08
R0592:Kdm2b UTSW 5 122961134 splice site probably benign
R0894:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R1078:Kdm2b UTSW 5 122961541 missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 122880268 missense probably damaging 1.00
R1441:Kdm2b UTSW 5 122932880 missense probably benign 0.25
R1550:Kdm2b UTSW 5 122881057 missense probably damaging 1.00
R1795:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R2060:Kdm2b UTSW 5 122883365 missense probably damaging 1.00
R2161:Kdm2b UTSW 5 122880699 missense probably damaging 1.00
R2259:Kdm2b UTSW 5 122882416 missense probably damaging 1.00
R3843:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3844:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3859:Kdm2b UTSW 5 122880227 missense probably damaging 1.00
R4506:Kdm2b UTSW 5 122888625 missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 122934786 missense probably damaging 0.99
R4786:Kdm2b UTSW 5 122880854 critical splice acceptor site probably null
R4894:Kdm2b UTSW 5 122940967 nonsense probably null
R5265:Kdm2b UTSW 5 122878588 missense probably damaging 1.00
R5522:Kdm2b UTSW 5 122949162 missense probably damaging 1.00
R5746:Kdm2b UTSW 5 122879364 missense probably damaging 1.00
R5813:Kdm2b UTSW 5 122871868 missense probably benign 0.37
R5920:Kdm2b UTSW 5 122880296 missense probably damaging 1.00
R5961:Kdm2b UTSW 5 122932661 missense probably benign 0.37
R6029:Kdm2b UTSW 5 122879587 missense probably damaging 1.00
R6303:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6304:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6383:Kdm2b UTSW 5 122934778 missense probably damaging 1.00
R6432:Kdm2b UTSW 5 122880191 missense probably damaging 1.00
R6513:Kdm2b UTSW 5 122880239 missense probably damaging 0.99
R6526:Kdm2b UTSW 5 122961469 missense probably damaging 1.00
R7213:Kdm2b UTSW 5 122921469 missense probably damaging 0.99
R7226:Kdm2b UTSW 5 122921449 missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 122880791 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCGCTGTAACCAGATACTG -3'
(R):5'- TCTGATGTGGAAGCTTCTAAGGATG -3'

Sequencing Primer
(F):5'- CCTGATAGGTTGACCTCTGTC -3'
(R):5'- AAGCTTCTAAGGATGAGATTCTGGC -3'
Posted On2018-03-15