Incidental Mutation 'R6280:Vmn2r19'
ID507895
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Namevomeronasal 2, receptor 19
SynonymsEG232358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6280 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123308333-123336537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123336253 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 761 (S761G)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
Predicted Effect probably benign
Transcript: ENSMUST00000073948
AA Change: S761G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: S761G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 unclassified probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R6742:Vmn2r19 UTSW 6 123329958 missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTTGCCTTCAATGCCATCAAAC -3'
(R):5'- CACAGCTACCATGGTTTTGCC -3'

Sequencing Primer
(F):5'- ATGGTGATCCGACTTTCATATGC -3'
(R):5'- GCCTTTGGAGCTCAGGTAAG -3'
Posted On2018-03-15