Mutagenetix > Incidental Mutation

Incidental Mutation 'R6280:Pou2f3'

507910

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6280 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43139340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 242 (L242M)

Ref Sequence

ENSEMBL: ENSMUSP00000135115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034513
AA Change: L230M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: L230M

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176636
AA Change: L242M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: L242M

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Meta Mutation Damage Score

0.3688

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,327,057	S534P	probably damaging	Het
4930452B06Rik	T	G	14: 8,473,414		probably null	Het
Abca12	C	T	1: 71,272,460	D1930N	probably benign	Het
Adam8	A	G	7: 139,984,807	L667S	probably damaging	Het
Adcy4	A	T	14: 55,779,043	I317N	probably damaging	Het
Agpat3	A	G	10: 78,285,038	F102S	probably damaging	Het
Apbb2	A	T	5: 66,364,982	W443R	probably damaging	Het
BC049715	T	A	6: 136,840,231	Y156*	probably null	Het
Bpifc	C	T	10: 85,977,712	V323I	probably benign	Het
Camp	T	G	9: 109,847,509	I149L	probably benign	Het
Cnih1	A	G	14: 46,788,177		probably null	Het
Col18a1	A	T	10: 77,112,489		probably benign	Het
Dsg4	A	T	18: 20,466,667	D780V	probably damaging	Het
Dync1i1	G	A	6: 5,972,084	V442I	probably benign	Het
Fam83g	G	T	11: 61,703,182	S514I	probably benign	Het
Fam92b	A	G	8: 120,172,119	I94T	possibly damaging	Het
Fbxo7	A	G	10: 86,029,105	N93D	probably benign	Het
Fgf20	G	T	8: 40,281,112	S76*	probably null	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Fxr1	G	A	3: 34,046,252		probably benign	Het
Gon4l	T	A	3: 88,890,888	L800H	probably damaging	Het
Gpn3	T	A	5: 122,373,959	S33T	probably benign	Het
Gria4	T	C	9: 4,456,072	M743V	probably damaging	Het
Hira	A	G	16: 18,910,707	N109D	probably damaging	Het
Hsd3b3	A	G	3: 98,753,305		probably null	Het
Hsf2	T	G	10: 57,511,495	S370A	probably benign	Het
Htt	T	A	5: 34,870,759	D1786E	probably benign	Het
Ifit1bl2	T	A	19: 34,620,134	R27S	possibly damaging	Het
Il17rb	G	A	14: 30,002,971	A186V	probably benign	Het
Irak4	G	T	15: 94,551,810	E57*	probably null	Het
Kcnh2	T	A	5: 24,331,923	H221L	probably benign	Het
Kdm2b	T	C	5: 122,878,624	N1149D	probably damaging	Het
Kif26a	A	G	12: 112,174,869	H702R	probably damaging	Het
Kmt2e	T	C	5: 23,499,516	S1236P	possibly damaging	Het
Krt77	T	A	15: 101,865,475	D248V	probably damaging	Het
Lgals3bp	T	C	11: 118,393,280	N52S	possibly damaging	Het
Lhfp	T	C	3: 53,260,514	Y170H	probably damaging	Het
Lpin2	A	G	17: 71,232,248		probably benign	Het
Lrig3	T	C	10: 126,010,979	I872T	probably benign	Het
Lrit3	T	C	3: 129,788,763	E525G	probably damaging	Het
Lrp1	T	C	10: 127,589,584	T726A	probably benign	Het
Mep1a	A	T	17: 43,502,392	N46K	probably damaging	Het
Muc16	C	A	9: 18,579,317		probably null	Het
N4bp1	A	C	8: 86,853,166	N669K	possibly damaging	Het
Nelfcd	A	G	2: 174,415,946	D26G	probably benign	Het
Neu4	G	A	1: 94,025,151	S414N	probably damaging	Het
Nudt9	A	G	5: 104,065,069	D336G	probably benign	Het
Obscn	C	A	11: 59,063,683	G3691V	possibly damaging	Het
Olfr1102	A	G	2: 87,002,020	N17S	probably damaging	Het
Olfr1263	A	C	2: 90,015,049	I40L	possibly damaging	Het
Pdgfd	T	A	9: 6,288,627	S94T	probably benign	Het
Picalm	A	G	7: 90,177,562	H290R	probably benign	Het
Prkd3	C	T	17: 78,981,931	G187D	probably damaging	Het
Pwp1	A	G	10: 85,874,462	S49G	probably damaging	Het
Ralgapa2	A	G	2: 146,342,209	L1626P	probably damaging	Het
Rin2	A	G	2: 145,861,019	Y545C	probably damaging	Het
Rwdd4a	A	G	8: 47,542,797	T71A	probably benign	Het
Senp7	T	C	16: 56,162,375	F504L	possibly damaging	Het
Slc12a6	A	G	2: 112,337,358	T231A	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc17a2	A	G	13: 23,822,394	S468G	probably benign	Het
Slc4a10	A	G	2: 62,281,966	N697S	probably benign	Het
Spint1	T	A	2: 119,245,278	V194E	possibly damaging	Het
Sptlc2	A	T	12: 87,388,131	M14K	probably benign	Het
Stard9	A	G	2: 120,701,127	K2622E	probably benign	Het
Tbc1d5	T	C	17: 50,782,310	N614S	probably benign	Het
Tdpoz2	A	T	3: 93,651,883	C261S	probably benign	Het
Tmem150b	A	T	7: 4,724,374	I44N	probably benign	Het
Ttn	A	G	2: 76,778,158	L17807P	probably damaging	Het
Vcan	G	A	13: 89,725,373	R121W	probably damaging	Het
Vmn2r15	T	A	5: 109,293,425	H189L	possibly damaging	Het
Vmn2r19	A	G	6: 123,336,253	S761G	probably benign	Het
Wdr11	A	T	7: 129,599,106	K34*	probably null	Het
Zfp120	A	T	2: 150,118,044	S141R	possibly damaging	Het
Zfp462	C	G	4: 55,010,253	P740A	probably benign	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTTCTTGGTTCGTGCCAG -3'
(R):5'- AAGATACAAGGCTGTGCGC -3'

Sequencing Primer
(F):5'- TTCGTGCCAGGCTGAAGAG -3'
(R):5'- AGATGCTCAGGGCTCTGACTG -3'

Posted On

2018-03-15