Mutagenetix > Incidental Mutation

Incidental Mutation 'R6280:Pwp1'

507915

Institutional Source

Beutler Lab

Gene Symbol

Pwp1

Ensembl Gene

ENSMUSG00000001785

Gene Name

PWP1 homolog, endonuclein

Synonyms

2610205J09Rik, 2310058A11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6280 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85829494-85889096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85874462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 49 (S49G)

Ref Sequence

ENSEMBL: ENSMUSP00000151813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000217667] [ENSMUST00000219256]

AlphaFold

Q99LL5

Predicted Effect

probably benign
Transcript: ENSMUST00000001836
AA Change: S49G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: S49G

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC
Blast:WD40	168	220	4e-27	BLAST
WD40	244	284	4.51e-7	SMART
WD40	287	327	3.37e-6	SMART
WD40	331	370	4.42e1	SMART
WD40	373	413	6.38e-7	SMART
Blast:WD40	418	458	3e-23	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000217667

Predicted Effect

probably damaging
Transcript: ENSMUST00000219256
AA Change: S49G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219626

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219902

Meta Mutation Damage Score

0.0621

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,327,057	S534P	probably damaging	Het
4930452B06Rik	T	G	14: 8,473,414		probably null	Het
Abca12	C	T	1: 71,272,460	D1930N	probably benign	Het
Adam8	A	G	7: 139,984,807	L667S	probably damaging	Het
Adcy4	A	T	14: 55,779,043	I317N	probably damaging	Het
Agpat3	A	G	10: 78,285,038	F102S	probably damaging	Het
Apbb2	A	T	5: 66,364,982	W443R	probably damaging	Het
BC049715	T	A	6: 136,840,231	Y156*	probably null	Het
Bpifc	C	T	10: 85,977,712	V323I	probably benign	Het
Camp	T	G	9: 109,847,509	I149L	probably benign	Het
Cnih1	A	G	14: 46,788,177		probably null	Het
Col18a1	A	T	10: 77,112,489		probably benign	Het
Dsg4	A	T	18: 20,466,667	D780V	probably damaging	Het
Dync1i1	G	A	6: 5,972,084	V442I	probably benign	Het
Fam83g	G	T	11: 61,703,182	S514I	probably benign	Het
Fam92b	A	G	8: 120,172,119	I94T	possibly damaging	Het
Fbxo7	A	G	10: 86,029,105	N93D	probably benign	Het
Fgf20	G	T	8: 40,281,112	S76*	probably null	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Fxr1	G	A	3: 34,046,252		probably benign	Het
Gon4l	T	A	3: 88,890,888	L800H	probably damaging	Het
Gpn3	T	A	5: 122,373,959	S33T	probably benign	Het
Gria4	T	C	9: 4,456,072	M743V	probably damaging	Het
Hira	A	G	16: 18,910,707	N109D	probably damaging	Het
Hsd3b3	A	G	3: 98,753,305		probably null	Het
Hsf2	T	G	10: 57,511,495	S370A	probably benign	Het
Htt	T	A	5: 34,870,759	D1786E	probably benign	Het
Ifit1bl2	T	A	19: 34,620,134	R27S	possibly damaging	Het
Il17rb	G	A	14: 30,002,971	A186V	probably benign	Het
Irak4	G	T	15: 94,551,810	E57*	probably null	Het
Kcnh2	T	A	5: 24,331,923	H221L	probably benign	Het
Kdm2b	T	C	5: 122,878,624	N1149D	probably damaging	Het
Kif26a	A	G	12: 112,174,869	H702R	probably damaging	Het
Kmt2e	T	C	5: 23,499,516	S1236P	possibly damaging	Het
Krt77	T	A	15: 101,865,475	D248V	probably damaging	Het
Lgals3bp	T	C	11: 118,393,280	N52S	possibly damaging	Het
Lhfp	T	C	3: 53,260,514	Y170H	probably damaging	Het
Lpin2	A	G	17: 71,232,248		probably benign	Het
Lrig3	T	C	10: 126,010,979	I872T	probably benign	Het
Lrit3	T	C	3: 129,788,763	E525G	probably damaging	Het
Lrp1	T	C	10: 127,589,584	T726A	probably benign	Het
Mep1a	A	T	17: 43,502,392	N46K	probably damaging	Het
Muc16	C	A	9: 18,579,317		probably null	Het
N4bp1	A	C	8: 86,853,166	N669K	possibly damaging	Het
Nelfcd	A	G	2: 174,415,946	D26G	probably benign	Het
Neu4	G	A	1: 94,025,151	S414N	probably damaging	Het
Nudt9	A	G	5: 104,065,069	D336G	probably benign	Het
Obscn	C	A	11: 59,063,683	G3691V	possibly damaging	Het
Olfr1102	A	G	2: 87,002,020	N17S	probably damaging	Het
Olfr1263	A	C	2: 90,015,049	I40L	possibly damaging	Het
Pdgfd	T	A	9: 6,288,627	S94T	probably benign	Het
Picalm	A	G	7: 90,177,562	H290R	probably benign	Het
Pou2f3	A	T	9: 43,139,339	L242Q	probably damaging	Het
Pou2f3	G	T	9: 43,139,340	L242M	probably damaging	Het
Prkd3	C	T	17: 78,981,931	G187D	probably damaging	Het
Ralgapa2	A	G	2: 146,342,209	L1626P	probably damaging	Het
Rin2	A	G	2: 145,861,019	Y545C	probably damaging	Het
Rwdd4a	A	G	8: 47,542,797	T71A	probably benign	Het
Senp7	T	C	16: 56,162,375	F504L	possibly damaging	Het
Slc12a6	A	G	2: 112,337,358	T231A	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc17a2	A	G	13: 23,822,394	S468G	probably benign	Het
Slc4a10	A	G	2: 62,281,966	N697S	probably benign	Het
Spint1	T	A	2: 119,245,278	V194E	possibly damaging	Het
Sptlc2	A	T	12: 87,388,131	M14K	probably benign	Het
Stard9	A	G	2: 120,701,127	K2622E	probably benign	Het
Tbc1d5	T	C	17: 50,782,310	N614S	probably benign	Het
Tdpoz2	A	T	3: 93,651,883	C261S	probably benign	Het
Tmem150b	A	T	7: 4,724,374	I44N	probably benign	Het
Ttn	A	G	2: 76,778,158	L17807P	probably damaging	Het
Vcan	G	A	13: 89,725,373	R121W	probably damaging	Het
Vmn2r15	T	A	5: 109,293,425	H189L	possibly damaging	Het
Vmn2r19	A	G	6: 123,336,253	S761G	probably benign	Het
Wdr11	A	T	7: 129,599,106	K34*	probably null	Het
Zfp120	A	T	2: 150,118,044	S141R	possibly damaging	Het
Zfp462	C	G	4: 55,010,253	P740A	probably benign	Het

Other mutations in Pwp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00707:Pwp1	APN	10	85878516	missense	probably damaging	1.00
IGL00778:Pwp1	APN	10	85879888	missense	probably benign	0.05
IGL01086:Pwp1	APN	10	85879893	splice site	probably null
IGL02526:Pwp1	APN	10	85882103	splice site	probably null
IGL02596:Pwp1	APN	10	85872018	splice site	probably null
IGL03164:Pwp1	APN	10	85878503	missense	probably benign	0.19
IGL03269:Pwp1	APN	10	85882904	missense	probably damaging	0.98
Annuals	UTSW	10	85876514	missense	probably damaging	1.00
R0031:Pwp1	UTSW	10	85885896	missense	probably benign	0.20
R0049:Pwp1	UTSW	10	85885616	missense	possibly damaging	0.67
R0049:Pwp1	UTSW	10	85885616	missense	possibly damaging	0.67
R0766:Pwp1	UTSW	10	85879309	missense	probably damaging	0.98
R0926:Pwp1	UTSW	10	85876514	missense	probably damaging	1.00
R1238:Pwp1	UTSW	10	85885862	missense	probably benign	0.02
R1312:Pwp1	UTSW	10	85879309	missense	probably damaging	0.98
R1420:Pwp1	UTSW	10	85876538	missense	probably damaging	1.00
R3177:Pwp1	UTSW	10	85882079	missense	probably benign	0.45
R3277:Pwp1	UTSW	10	85882079	missense	probably benign	0.45
R3818:Pwp1	UTSW	10	85888129	missense	possibly damaging	0.76
R4008:Pwp1	UTSW	10	85882034	missense	possibly damaging	0.60
R5964:Pwp1	UTSW	10	85882886	missense	probably damaging	1.00
R6252:Pwp1	UTSW	10	85874509	missense	probably benign	0.00
R6765:Pwp1	UTSW	10	85884533	missense	probably damaging	0.99
R7168:Pwp1	UTSW	10	85884537	missense	probably damaging	1.00
R7213:Pwp1	UTSW	10	85876309	missense	probably benign
R7236:Pwp1	UTSW	10	85879283	missense	probably benign	0.00
R7840:Pwp1	UTSW	10	85888050	missense	probably damaging	1.00
R9025:Pwp1	UTSW	10	85882881	missense	probably damaging	1.00
R9063:Pwp1	UTSW	10	85884567	missense	probably benign	0.00
R9366:Pwp1	UTSW	10	85882006	missense	probably damaging	0.99
R9451:Pwp1	UTSW	10	85878564	missense	probably damaging	0.99
R9535:Pwp1	UTSW	10	85888094	missense	possibly damaging	0.57
R9563:Pwp1	UTSW	10	85876506	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTCCCTTGTAGGTAGAGC -3'
(R):5'- CTTTGGGATAGCAGGCTCTAG -3'

Sequencing Primer
(F):5'- TCCCTTGTAGGTAGAGCTAAGTAAAG -3'
(R):5'- TAGAGCCACCTCTCACCTGG -3'

Posted On

2018-03-15