Incidental Mutation 'R6280:Kif26a'
ID507925
Institutional Source Beutler Lab
Gene Symbol Kif26a
Ensembl Gene ENSMUSG00000021294
Gene Namekinesin family member 26A
SynonymsN-11 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R6280 (G1)
Quality Score168.009
Status Validated
Chromosome12
Chromosomal Location112146208-112181747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112174869 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 702 (H702R)
Ref Sequence ENSEMBL: ENSMUSP00000119482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128402]
Predicted Effect probably damaging
Transcript: ENSMUST00000128402
AA Change: H702R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: H702R

DomainStartEndE-ValueType
low complexity region 238 248 N/A INTRINSIC
low complexity region 279 297 N/A INTRINSIC
KISc 362 726 9.57e-35 SMART
low complexity region 727 739 N/A INTRINSIC
low complexity region 740 754 N/A INTRINSIC
low complexity region 932 957 N/A INTRINSIC
low complexity region 1005 1012 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1328 1360 N/A INTRINSIC
low complexity region 1458 1471 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1519 1538 N/A INTRINSIC
low complexity region 1574 1587 N/A INTRINSIC
low complexity region 1664 1675 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
coiled coil region 1780 1812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Senp7 T C 16: 56,162,375 F504L possibly damaging Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Kif26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Kif26a APN 12 112157632 missense probably damaging 0.97
IGL01734:Kif26a APN 12 112176828 missense probably benign 0.23
IGL01916:Kif26a APN 12 112176894 missense possibly damaging 0.49
IGL02080:Kif26a APN 12 112157566 missense probably damaging 1.00
IGL02138:Kif26a APN 12 112174850 missense probably damaging 1.00
IGL02145:Kif26a APN 12 112176975 missense probably benign 0.00
IGL02285:Kif26a APN 12 112157507 missense probably damaging 1.00
IGL02393:Kif26a APN 12 112172664 missense probably damaging 1.00
IGL02445:Kif26a APN 12 112173743 missense probably damaging 1.00
IGL02865:Kif26a APN 12 112177615 nonsense probably null
IGL03057:Kif26a APN 12 112175774 nonsense probably null
IGL03204:Kif26a APN 12 112174779 missense probably damaging 1.00
R0013:Kif26a UTSW 12 112177880 missense probably benign 0.03
R0034:Kif26a UTSW 12 112168963 splice site probably benign
R0089:Kif26a UTSW 12 112177403 missense probably damaging 0.98
R0111:Kif26a UTSW 12 112163337 splice site probably benign
R0220:Kif26a UTSW 12 112157390 missense probably damaging 0.98
R0346:Kif26a UTSW 12 112179348 missense probably null 0.09
R0383:Kif26a UTSW 12 112178076 missense possibly damaging 0.94
R0478:Kif26a UTSW 12 112175789 missense probably damaging 1.00
R0494:Kif26a UTSW 12 112179471 splice site probably null
R1163:Kif26a UTSW 12 112179945 missense probably benign 0.08
R1450:Kif26a UTSW 12 112173852 missense probably damaging 1.00
R1512:Kif26a UTSW 12 112146955 missense possibly damaging 0.47
R1616:Kif26a UTSW 12 112157246 critical splice acceptor site probably null
R1723:Kif26a UTSW 12 112173858 missense possibly damaging 0.67
R1728:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1729:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1903:Kif26a UTSW 12 112175540 missense probably damaging 1.00
R2283:Kif26a UTSW 12 112177353 missense possibly damaging 0.66
R3862:Kif26a UTSW 12 112179889 missense probably benign 0.30
R3906:Kif26a UTSW 12 112176890 missense probably benign
R4050:Kif26a UTSW 12 112179916 missense probably benign 0.08
R4270:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4271:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4731:Kif26a UTSW 12 112175573 missense probably benign
R4732:Kif26a UTSW 12 112175573 missense probably benign
R4733:Kif26a UTSW 12 112175573 missense probably benign
R4908:Kif26a UTSW 12 112157342 missense probably damaging 1.00
R4946:Kif26a UTSW 12 112177794 missense probably damaging 0.99
R5566:Kif26a UTSW 12 112157354 missense probably damaging 1.00
R6422:Kif26a UTSW 12 112168875 missense possibly damaging 0.95
R6513:Kif26a UTSW 12 112175492 missense probably damaging 0.97
R6860:Kif26a UTSW 12 112146829 missense probably damaging 1.00
R6879:Kif26a UTSW 12 112177653 missense probably benign
R7127:Kif26a UTSW 12 112178145 missense probably damaging 1.00
R7366:Kif26a UTSW 12 112163542 critical splice donor site probably null
R7595:Kif26a UTSW 12 112179325 missense probably benign 0.30
R7630:Kif26a UTSW 12 112175697 missense probably damaging 1.00
R7784:Kif26a UTSW 12 112178147 missense possibly damaging 0.66
X0027:Kif26a UTSW 12 112176070 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AATGGTCTACATCTCACCTGGC -3'
(R):5'- AAGCATTCTACCCCTGCTCAG -3'

Sequencing Primer
(F):5'- ACCTGGCCTTTTCCCTAGACTG -3'
(R):5'- ACTTGGGGCCTAAGAGGTC -3'
Posted On2018-03-15