Incidental Mutation 'R6280:Senp7'
ID507933
Institutional Source Beutler Lab
Gene Symbol Senp7
Ensembl Gene ENSMUSG00000052917
Gene NameSUMO1/sentrin specific peptidase 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6280 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56048338-56190012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56162375 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 504 (F504L)
Ref Sequence ENSEMBL: ENSMUSP00000086776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089360] [ENSMUST00000089362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089360
AA Change: F504L

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086776
Gene: ENSMUSG00000052917
AA Change: F504L

DomainStartEndE-ValueType
low complexity region 165 181 N/A INTRINSIC
low complexity region 352 376 N/A INTRINSIC
low complexity region 386 395 N/A INTRINSIC
low complexity region 639 646 N/A INTRINSIC
Pfam:Peptidase_C48 734 999 7.8e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089362
AA Change: F531L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086779
Gene: ENSMUSG00000052917
AA Change: F531L

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 666 673 N/A INTRINSIC
Pfam:Peptidase_C48 761 1026 8.5e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a SUMO deconjugating enzyme of the Sentrin/SUMO-specific protease (SENP) family. The encoded protein is a protease that exhibits deSUMOylating activity towards proteins involved in chromatin remodeling and promotes chromatin relaxation for DNA repair or transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,057 S534P probably damaging Het
4930452B06Rik T G 14: 8,473,414 probably null Het
Abca12 C T 1: 71,272,460 D1930N probably benign Het
Adam8 A G 7: 139,984,807 L667S probably damaging Het
Adcy4 A T 14: 55,779,043 I317N probably damaging Het
Agpat3 A G 10: 78,285,038 F102S probably damaging Het
Apbb2 A T 5: 66,364,982 W443R probably damaging Het
BC049715 T A 6: 136,840,231 Y156* probably null Het
Bpifc C T 10: 85,977,712 V323I probably benign Het
Camp T G 9: 109,847,509 I149L probably benign Het
Cnih1 A G 14: 46,788,177 probably null Het
Col18a1 A T 10: 77,112,489 probably benign Het
Dsg4 A T 18: 20,466,667 D780V probably damaging Het
Dync1i1 G A 6: 5,972,084 V442I probably benign Het
Fam83g G T 11: 61,703,182 S514I probably benign Het
Fam92b A G 8: 120,172,119 I94T possibly damaging Het
Fbxo7 A G 10: 86,029,105 N93D probably benign Het
Fgf20 G T 8: 40,281,112 S76* probably null Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Fxr1 G A 3: 34,046,252 probably benign Het
Gon4l T A 3: 88,890,888 L800H probably damaging Het
Gpn3 T A 5: 122,373,959 S33T probably benign Het
Gria4 T C 9: 4,456,072 M743V probably damaging Het
Hira A G 16: 18,910,707 N109D probably damaging Het
Hsd3b3 A G 3: 98,753,305 probably null Het
Hsf2 T G 10: 57,511,495 S370A probably benign Het
Htt T A 5: 34,870,759 D1786E probably benign Het
Ifit1bl2 T A 19: 34,620,134 R27S possibly damaging Het
Il17rb G A 14: 30,002,971 A186V probably benign Het
Irak4 G T 15: 94,551,810 E57* probably null Het
Kcnh2 T A 5: 24,331,923 H221L probably benign Het
Kdm2b T C 5: 122,878,624 N1149D probably damaging Het
Kif26a A G 12: 112,174,869 H702R probably damaging Het
Kmt2e T C 5: 23,499,516 S1236P possibly damaging Het
Krt77 T A 15: 101,865,475 D248V probably damaging Het
Lgals3bp T C 11: 118,393,280 N52S possibly damaging Het
Lhfp T C 3: 53,260,514 Y170H probably damaging Het
Lpin2 A G 17: 71,232,248 probably benign Het
Lrig3 T C 10: 126,010,979 I872T probably benign Het
Lrit3 T C 3: 129,788,763 E525G probably damaging Het
Lrp1 T C 10: 127,589,584 T726A probably benign Het
Mep1a A T 17: 43,502,392 N46K probably damaging Het
Muc16 C A 9: 18,579,317 probably null Het
N4bp1 A C 8: 86,853,166 N669K possibly damaging Het
Nelfcd A G 2: 174,415,946 D26G probably benign Het
Neu4 G A 1: 94,025,151 S414N probably damaging Het
Nudt9 A G 5: 104,065,069 D336G probably benign Het
Obscn C A 11: 59,063,683 G3691V possibly damaging Het
Olfr1102 A G 2: 87,002,020 N17S probably damaging Het
Olfr1263 A C 2: 90,015,049 I40L possibly damaging Het
Pdgfd T A 9: 6,288,627 S94T probably benign Het
Picalm A G 7: 90,177,562 H290R probably benign Het
Pou2f3 A T 9: 43,139,339 L242Q probably damaging Het
Pou2f3 G T 9: 43,139,340 L242M probably damaging Het
Prkd3 C T 17: 78,981,931 G187D probably damaging Het
Pwp1 A G 10: 85,874,462 S49G probably damaging Het
Ralgapa2 A G 2: 146,342,209 L1626P probably damaging Het
Rin2 A G 2: 145,861,019 Y545C probably damaging Het
Rwdd4a A G 8: 47,542,797 T71A probably benign Het
Slc12a6 A G 2: 112,337,358 T231A probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc17a2 A G 13: 23,822,394 S468G probably benign Het
Slc4a10 A G 2: 62,281,966 N697S probably benign Het
Spint1 T A 2: 119,245,278 V194E possibly damaging Het
Sptlc2 A T 12: 87,388,131 M14K probably benign Het
Stard9 A G 2: 120,701,127 K2622E probably benign Het
Tbc1d5 T C 17: 50,782,310 N614S probably benign Het
Tdpoz2 A T 3: 93,651,883 C261S probably benign Het
Tmem150b A T 7: 4,724,374 I44N probably benign Het
Ttn A G 2: 76,778,158 L17807P probably damaging Het
Vcan G A 13: 89,725,373 R121W probably damaging Het
Vmn2r15 T A 5: 109,293,425 H189L possibly damaging Het
Vmn2r19 A G 6: 123,336,253 S761G probably benign Het
Wdr11 A T 7: 129,599,106 K34* probably null Het
Zfp120 A T 2: 150,118,044 S141R possibly damaging Het
Zfp462 C G 4: 55,010,253 P740A probably benign Het
Other mutations in Senp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Senp7 APN 16 56082377 missense probably damaging 0.96
IGL01610:Senp7 APN 16 56175823 missense possibly damaging 0.94
IGL01627:Senp7 APN 16 56171856 missense probably damaging 1.00
IGL02748:Senp7 APN 16 56186094 missense probably damaging 1.00
IGL03031:Senp7 APN 16 56175886 missense probably damaging 1.00
IGL03083:Senp7 APN 16 56171865 missense probably benign 0.28
R0034:Senp7 UTSW 16 56153570 missense possibly damaging 0.63
R0200:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0547:Senp7 UTSW 16 56175826 missense probably damaging 1.00
R0608:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R1595:Senp7 UTSW 16 56184768 missense probably damaging 1.00
R1737:Senp7 UTSW 16 56123799 missense probably damaging 1.00
R1837:Senp7 UTSW 16 56158516 missense probably benign 0.01
R1945:Senp7 UTSW 16 56123946 missense probably damaging 0.98
R2143:Senp7 UTSW 16 56169806 missense probably benign
R2275:Senp7 UTSW 16 56184783 missense probably damaging 1.00
R2508:Senp7 UTSW 16 56151362 missense probably benign 0.28
R3404:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3405:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3717:Senp7 UTSW 16 56179057 splice site probably benign
R3885:Senp7 UTSW 16 56186079 missense probably damaging 1.00
R4159:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4160:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4161:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4512:Senp7 UTSW 16 56165883 missense probably damaging 1.00
R5291:Senp7 UTSW 16 56186179 nonsense probably null
R5315:Senp7 UTSW 16 56180526 missense probably benign 0.26
R5390:Senp7 UTSW 16 56169916 missense probably benign
R5424:Senp7 UTSW 16 56186108 missense possibly damaging 0.82
R5643:Senp7 UTSW 16 56184149 splice site silent
R5644:Senp7 UTSW 16 56184149 splice site silent
R5645:Senp7 UTSW 16 56173208 missense possibly damaging 0.80
R5799:Senp7 UTSW 16 56139105 splice site probably null
R5860:Senp7 UTSW 16 56155359 missense possibly damaging 0.49
R5954:Senp7 UTSW 16 56169871 missense probably benign 0.04
R6164:Senp7 UTSW 16 56169754 missense probably damaging 1.00
R6647:Senp7 UTSW 16 56173255 missense probably damaging 1.00
R6652:Senp7 UTSW 16 56123894 missense probably benign 0.08
R7310:Senp7 UTSW 16 56186082 missense probably benign 0.18
R7460:Senp7 UTSW 16 56173182 missense possibly damaging 0.65
R7480:Senp7 UTSW 16 56155226 missense possibly damaging 0.80
R7609:Senp7 UTSW 16 56111637 missense probably benign 0.06
U24488:Senp7 UTSW 16 56184819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTCGTAAACAACCGTAAGACG -3'
(R):5'- CAAAATATTTGTCTGTCGAGCTTTG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- ACTGCTAAAATTGTTAACATGAAACG -3'
Posted On2018-03-15