Incidental Mutation 'R6281:Cat'
ID507944
Institutional Source Beutler Lab
Gene Symbol Cat
Ensembl Gene ENSMUSG00000027187
Gene Namecatalase
SynonymsCas1, Cas-1, Cs-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103453849-103485160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103471769 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 194 (H194Q)
Ref Sequence ENSEMBL: ENSMUSP00000028610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]
Predicted Effect probably damaging
Transcript: ENSMUST00000028610
AA Change: H194Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: H194Q

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111168
SMART Domains Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 176 2.33e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Cat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02989:Cat APN 2 103472973 missense probably damaging 1.00
PIT4696001:Cat UTSW 2 103471812 missense probably damaging 0.99
R1968:Cat UTSW 2 103484989 missense probably benign 0.01
R2103:Cat UTSW 2 103463315 missense probably damaging 1.00
R2655:Cat UTSW 2 103471846 missense probably damaging 1.00
R3037:Cat UTSW 2 103467777 missense probably benign 0.07
R5287:Cat UTSW 2 103474360 missense probably damaging 1.00
R5527:Cat UTSW 2 103472973 missense probably damaging 1.00
R5694:Cat UTSW 2 103472994 missense probably damaging 1.00
R6089:Cat UTSW 2 103472951 missense probably null 0.48
R6177:Cat UTSW 2 103473075 missense probably damaging 1.00
R6294:Cat UTSW 2 103460295 missense probably benign
R7058:Cat UTSW 2 103474353 missense probably benign 0.31
R7274:Cat UTSW 2 103476890 missense probably benign 0.07
R7347:Cat UTSW 2 103463298 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTCCAACCATCTAAGCATCATG -3'
(R):5'- CCAAAGATGGTTGTATGTACTGAAC -3'

Sequencing Primer
(F):5'- CAACCATCTAAGCATCATGTTAGATG -3'
(R):5'- TGAAAGTTTAGCAATCTAGTTTCTGG -3'
Posted On2018-03-15