Incidental Mutation 'R6281:Olfr1283'
ID507945
Institutional Source Beutler Lab
Gene Symbol Olfr1283
Ensembl Gene ENSMUSG00000109322
Gene Nameolfactory receptor 1283
SynonymsGA_x6K02T2Q125-72420217-72421134, MOR248-19
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111366790-111370063 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 111369549 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 306 (*306R)
Ref Sequence ENSEMBL: ENSMUSP00000150510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]
Predicted Effect probably null
Transcript: ENSMUST00000090328
AA Change: *306R
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: *306R

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204064
AA Change: *306R
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: *306R

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216637
AA Change: *306R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Olfr1283
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Olfr1283 APN 2 111369151 missense probably benign 0.22
IGL02716:Olfr1283 APN 2 111368781 missense probably benign 0.04
R0090:Olfr1283 UTSW 2 111369294 missense probably damaging 1.00
R0141:Olfr1283 UTSW 2 111369490 missense probably damaging 1.00
R0371:Olfr1283 UTSW 2 111369153 missense probably benign 0.00
R0417:Olfr1283 UTSW 2 111369105 missense possibly damaging 0.57
R1673:Olfr1283 UTSW 2 111369207 missense probably benign 0.11
R1970:Olfr1283 UTSW 2 111369076 missense probably benign 0.19
R2069:Olfr1283 UTSW 2 111369095 missense probably benign 0.43
R3897:Olfr1283 UTSW 2 111368761 missense possibly damaging 0.87
R4408:Olfr1283 UTSW 2 111369280 missense possibly damaging 0.63
R5397:Olfr1283 UTSW 2 111368940 missense probably benign 0.00
R5888:Olfr1283 UTSW 2 111368743 missense probably benign
R6323:Olfr1283 UTSW 2 111368701 missense possibly damaging 0.94
R6801:Olfr1283 UTSW 2 111369049 missense probably benign 0.22
R7219:Olfr1283 UTSW 2 111369537 missense probably benign
R7271:Olfr1283 UTSW 2 111369348 missense probably damaging 1.00
R7438:Olfr1283 UTSW 2 111369362 missense probably damaging 1.00
R7761:Olfr1283 UTSW 2 111368793 missense probably benign 0.00
R7792:Olfr1283 UTSW 2 111369403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCCATATCATAGTGGTTCTGCTG -3'
(R):5'- TTTAACAATGTTGGGAGCACAG -3'

Sequencing Primer
(F):5'- CTGCTGTTCTTTGGGCCAGTC -3'
(R):5'- CTCATTCTAAGGGATTAAGCTACAAG -3'
Posted On2018-03-15