Incidental Mutation 'R6282:Olfr1178'
ID507985
Institutional Source Beutler Lab
Gene Symbol Olfr1178
Ensembl Gene ENSMUSG00000056995
Gene Nameolfactory receptor 1178
SynonymsGA_x6K02T2Q125-49870417-49871388, MOR225-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88387062-88400799 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 88391533 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 95 (C95*)
Ref Sequence ENSEMBL: ENSMUSP00000150036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075640] [ENSMUST00000214040]
Predicted Effect probably null
Transcript: ENSMUST00000075640
AA Change: C95*
SMART Domains Protein: ENSMUSP00000075066
Gene: ENSMUSG00000056995
AA Change: C95*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-49 PFAM
Pfam:7tm_1 39 285 7.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214040
AA Change: C95*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219086
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Olfr1178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr1178 APN 2 88391901 missense possibly damaging 0.79
IGL02261:Olfr1178 APN 2 88391381 missense probably benign 0.05
IGL03023:Olfr1178 APN 2 88391343 missense probably damaging 1.00
IGL03053:Olfr1178 APN 2 88391594 missense probably damaging 1.00
IGL03168:Olfr1178 APN 2 88391594 missense probably damaging 1.00
R0432:Olfr1178 UTSW 2 88392033 missense probably damaging 0.98
R1738:Olfr1178 UTSW 2 88391327 missense probably benign 0.01
R2051:Olfr1178 UTSW 2 88391538 missense possibly damaging 0.49
R2136:Olfr1178 UTSW 2 88391319 missense probably benign 0.24
R3236:Olfr1178 UTSW 2 88391406 missense probably benign 0.01
R4407:Olfr1178 UTSW 2 88392083 missense probably benign 0.37
R4930:Olfr1178 UTSW 2 88391940 missense probably benign 0.12
R4959:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R4973:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R5178:Olfr1178 UTSW 2 88391475 missense possibly damaging 0.50
R5411:Olfr1178 UTSW 2 88391261 missense probably benign 0.01
R7289:Olfr1178 UTSW 2 88391706 missense probably damaging 0.99
R7493:Olfr1178 UTSW 2 88391880 missense possibly damaging 0.94
R7591:Olfr1178 UTSW 2 88391876 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCTAGGGCTTTCTCAGACAAAAG -3'
(R):5'- TTGACCAAAGGAATGCAGAAATCC -3'

Sequencing Primer
(F):5'- GGGCTTTCTCAGACAAAAGAAATAG -3'
(R):5'- GGAATGCAGAAATCCCCCAG -3'
Posted On2018-03-15