Incidental Mutation 'R6282:Sars'
ID507986
Institutional Source Beutler Lab
Gene Symbol Sars
Ensembl Gene ENSMUSG00000068739
Gene Nameseryl-aminoacyl-tRNA synthetase
SynonymsStrs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108424865-108445209 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 108428274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 338 (S338*)
Ref Sequence ENSEMBL: ENSMUSP00000120879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090553] [ENSMUST00000102625] [ENSMUST00000132467] [ENSMUST00000153499]
Predicted Effect probably null
Transcript: ENSMUST00000090553
AA Change: S386*
SMART Domains Protein: ENSMUSP00000088041
Gene: ENSMUSG00000068739
AA Change: S386*

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-20 PFAM
Pfam:tRNA-synt_2b 203 386 4.1e-39 PFAM
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102625
AA Change: S386*
SMART Domains Protein: ENSMUSP00000099685
Gene: ENSMUSG00000068739
AA Change: S386*

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.3e-22 PFAM
Pfam:tRNA-synt_2b 248 427 2.1e-41 PFAM
low complexity region 505 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132467
AA Change: S338*
SMART Domains Protein: ENSMUSP00000120879
Gene: ENSMUSG00000068739
AA Change: S338*

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 6.1e-23 PFAM
Pfam:tRNA-synt_2b 155 338 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153499
SMART Domains Protein: ENSMUSP00000118676
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-23 PFAM
PDB:3VBB|F 150 187 3e-18 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Sars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Sars APN 3 108426858 missense probably damaging 0.99
IGL02898:Sars APN 3 108429263 missense probably damaging 1.00
R0660:Sars UTSW 3 108431473 missense probably damaging 1.00
R0749:Sars UTSW 3 108428266 missense possibly damaging 0.95
R0855:Sars UTSW 3 108426932 missense probably benign 0.07
R1249:Sars UTSW 3 108435935 missense probably benign 0.14
R1540:Sars UTSW 3 108433145 missense probably benign 0.01
R1659:Sars UTSW 3 108429416 missense probably damaging 1.00
R1836:Sars UTSW 3 108435944 missense probably benign 0.00
R2120:Sars UTSW 3 108434156 missense probably benign 0.00
R3104:Sars UTSW 3 108429305 missense probably damaging 1.00
R3105:Sars UTSW 3 108429305 missense probably damaging 1.00
R7224:Sars UTSW 3 108428203 missense probably damaging 1.00
R7706:Sars UTSW 3 108431464 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTGAGCTGATTTTCTCATGATG -3'
(R):5'- CCGGAGCATTTGGTGATGAG -3'

Sequencing Primer
(F):5'- TCTCATGATGCTGGAAACATACACTC -3'
(R):5'- ATGAGATCTGAGTGTGATTTCCC -3'
Posted On2018-03-15