Incidental Mutation 'R6282:Ldb2'
ID507993
Institutional Source Beutler Lab
Gene Symbol Ldb2
Ensembl Gene ENSMUSG00000039706
Gene NameLIM domain binding 2
SynonymsCLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location44472132-44799680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44532665 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000143289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]
Predicted Effect probably damaging
Transcript: ENSMUST00000070748
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: L204P

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 9.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2JTN|A 293 337 2e-21 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198356
Predicted Effect probably damaging
Transcript: ENSMUST00000199256
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706
AA Change: L204P

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 6.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199261
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: L204P

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2.3e-68 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2YPA|D 296 335 2e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199471
Predicted Effect probably damaging
Transcript: ENSMUST00000199534
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706
AA Change: L204P

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2e-71 PFAM
low complexity region 249 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Ldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Ldb2 APN 5 44541684 splice site probably null
IGL01757:Ldb2 APN 5 44541867 splice site probably benign
IGL01936:Ldb2 APN 5 44480244 missense probably damaging 1.00
IGL03105:Ldb2 APN 5 44799373 missense possibly damaging 0.70
IGL03108:Ldb2 APN 5 44541715 missense probably damaging 1.00
R0152:Ldb2 UTSW 5 44541799 missense possibly damaging 0.86
R0178:Ldb2 UTSW 5 44473499 missense probably damaging 1.00
R0841:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1318:Ldb2 UTSW 5 44535037 critical splice donor site probably null
R1607:Ldb2 UTSW 5 44473472 missense probably damaging 0.99
R2863:Ldb2 UTSW 5 44480324 missense probably damaging 0.99
R3803:Ldb2 UTSW 5 44473394 missense probably benign 0.38
R4502:Ldb2 UTSW 5 44669407 missense probably damaging 1.00
R4613:Ldb2 UTSW 5 44476551 missense probably benign 0.27
R4985:Ldb2 UTSW 5 44480303 missense probably damaging 1.00
R5475:Ldb2 UTSW 5 44541832 missense probably damaging 1.00
R5512:Ldb2 UTSW 5 44480244 missense probably damaging 1.00
R6058:Ldb2 UTSW 5 44476563 missense possibly damaging 0.66
R6438:Ldb2 UTSW 5 44480310 missense probably damaging 0.98
R6770:Ldb2 UTSW 5 44669396 missense probably damaging 0.99
R6830:Ldb2 UTSW 5 44541857 missense probably damaging 1.00
R8061:Ldb2 UTSW 5 44480270 missense probably damaging 1.00
X0026:Ldb2 UTSW 5 44532728 missense probably damaging 0.99
X0028:Ldb2 UTSW 5 44541794 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTATGGCCTAGGTTATGCAGC -3'
(R):5'- AAATTGTCTCCAGCAATCTATCCC -3'

Sequencing Primer
(F):5'- CCTAGGTTATGCAGCTGGCTTATAC -3'
(R):5'- GAGTGTCAAGAATGTGCATTTCAGC -3'
Posted On2018-03-15