Mutagenetix > Incidental Mutations

Incidental Mutation 'R6282:Ldb2'

507993

Institutional Source

Beutler Lab

Gene Symbol

Ldb2

Ensembl Gene

ENSMUSG00000039706

Gene Name

LIM domain binding 2

Synonyms

CLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6282 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44472132-44799680 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44532665 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 204 (L204P)

Ref Sequence

ENSEMBL: ENSMUSP00000143289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070748
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: L204P

Domain	Start	End	E-Value	Type
Pfam:LIM_bind	30	232	9.9e-56	PFAM
low complexity region	249	281	N/A	INTRINSIC
PDB:2JTN\|A	293	337	2e-21	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198356

Predicted Effect

probably damaging
Transcript: ENSMUST00000199256
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706
AA Change: L204P

Domain	Start	End	E-Value	Type
Pfam:LIM_bind	30	232	6.9e-56	PFAM
low complexity region	249	281	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000199261
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: L204P

Domain	Start	End	E-Value	Type
Pfam:LIM_bind	29	233	2.3e-68	PFAM
low complexity region	249	281	N/A	INTRINSIC
PDB:2YPA\|D	296	335	2e-20	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199471

Predicted Effect

probably damaging
Transcript: ENSMUST00000199534
AA Change: L204P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706
AA Change: L204P

Domain	Start	End	E-Value	Type
Pfam:LIM_bind	29	233	2e-71	PFAM
low complexity region	249	281	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,800,769	L185Q	possibly damaging	Het
Abca6	A	T	11: 110,208,824	C966S	probably damaging	Het
Atp13a4	A	T	16: 29,434,004	I708N	probably benign	Het
Axin1	C	G	17: 26,143,037	D118E	probably damaging	Het
Bace2	A	T	16: 97,415,097	I297F	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Ccdc30	T	A	4: 119,324,017	D649V	probably damaging	Het
Cd180	G	A	13: 102,693,757	A20T	possibly damaging	Het
Cdk18	T	C	1: 132,120,020	D112G	probably damaging	Het
Cuedc1	A	G	11: 88,183,402	N254S	probably damaging	Het
Dnah7a	T	C	1: 53,503,601	H2470R	probably damaging	Het
Drap1	G	A	19: 5,424,436		probably null	Het
Fam196b	A	G	11: 34,402,819	D287G	possibly damaging	Het
Fbxo5	T	A	10: 5,801,216	K257M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm12790	A	G	4: 101,967,516	V185A	possibly damaging	Het
Gm7361	A	G	5: 26,260,413	N136S	probably benign	Het
Il10ra	C	A	9: 45,260,405	C255F	probably damaging	Het
Itgam	A	T	7: 128,084,942	T340S	probably benign	Het
Ktn1	A	T	14: 47,663,971	N62I	probably damaging	Het
Map2k4	T	C	11: 65,707,016	T90A	possibly damaging	Het
Mettl3	A	T	14: 52,297,971	D287E	probably benign	Het
Mier2	A	G	10: 79,544,742	F278S	probably damaging	Het
Mis18bp1	A	G	12: 65,149,163	M609T	probably benign	Het
Myo1d	A	T	11: 80,557,512	V929D	probably damaging	Het
Naprt	A	T	15: 75,891,979	M364K	probably benign	Het
Nod2	T	A	8: 88,670,460	C833S	probably benign	Het
Nrip3	C	T	7: 109,763,479		probably null	Het
Ntsr2	A	G	12: 16,658,425	Y320C	probably damaging	Het
Olfr1178	C	A	2: 88,391,533	C95*	probably null	Het
Olfr555	G	A	7: 102,659,647	M275I	probably benign	Het
Olfr761	G	A	17: 37,952,424	S200F	possibly damaging	Het
Osbpl3	A	T	6: 50,348,083		probably null	Het
Pcdhb3	C	T	18: 37,301,646	R222C	probably damaging	Het
Pik3cd	G	T	4: 149,659,743	R184S	probably benign	Het
Rad50	A	T	11: 53,669,770		probably null	Het
Rad51ap2	A	T	12: 11,457,559	H494L	probably benign	Het
Rbm25	T	C	12: 83,676,089	M762T	probably damaging	Het
Sars	G	T	3: 108,428,274	S338*	probably null	Het
Usp35	T	C	7: 97,325,948	E6G	probably damaging	Het
Vash2	T	C	1: 190,960,225	Y251C	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20	T	A	12: 110,797,009		probably benign	Het
Wfdc1	G	A	8: 119,679,407	C87Y	probably damaging	Het
Zfp985	T	A	4: 147,583,348	H224Q	probably benign	Het

Other mutations in Ldb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Ldb2	APN	5	44541684	splice site	probably null
IGL01757:Ldb2	APN	5	44541867	splice site	probably benign
IGL01936:Ldb2	APN	5	44480244	missense	probably damaging	1.00
IGL03105:Ldb2	APN	5	44799373	missense	possibly damaging	0.70
IGL03108:Ldb2	APN	5	44541715	missense	probably damaging	1.00
R0152:Ldb2	UTSW	5	44541799	missense	possibly damaging	0.86
R0178:Ldb2	UTSW	5	44473499	missense	probably damaging	1.00
R0841:Ldb2	UTSW	5	44532674	missense	probably damaging	1.00
R1145:Ldb2	UTSW	5	44532674	missense	probably damaging	1.00
R1145:Ldb2	UTSW	5	44532674	missense	probably damaging	1.00
R1318:Ldb2	UTSW	5	44535037	critical splice donor site	probably null
R1607:Ldb2	UTSW	5	44473472	missense	probably damaging	0.99
R2863:Ldb2	UTSW	5	44480324	missense	probably damaging	0.99
R3803:Ldb2	UTSW	5	44473394	missense	probably benign	0.38
R4502:Ldb2	UTSW	5	44669407	missense	probably damaging	1.00
R4613:Ldb2	UTSW	5	44476551	missense	probably benign	0.27
R4985:Ldb2	UTSW	5	44480303	missense	probably damaging	1.00
R5475:Ldb2	UTSW	5	44541832	missense	probably damaging	1.00
R5512:Ldb2	UTSW	5	44480244	missense	probably damaging	1.00
R6058:Ldb2	UTSW	5	44476563	missense	possibly damaging	0.66
R6438:Ldb2	UTSW	5	44480310	missense	probably damaging	0.98
R6770:Ldb2	UTSW	5	44669396	missense	probably damaging	0.99
R6830:Ldb2	UTSW	5	44541857	missense	probably damaging	1.00
R8061:Ldb2	UTSW	5	44480270	missense	probably damaging	1.00
X0026:Ldb2	UTSW	5	44532728	missense	probably damaging	0.99
X0028:Ldb2	UTSW	5	44541794	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTATGGCCTAGGTTATGCAGC -3'
(R):5'- AAATTGTCTCCAGCAATCTATCCC -3'

Sequencing Primer
(F):5'- CCTAGGTTATGCAGCTGGCTTATAC -3'
(R):5'- GAGTGTCAAGAATGTGCATTTCAGC -3'

Posted On

2018-03-15