Incidental Mutation 'R6282:Itgam'
ID507998
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Nameintegrin alpha M
SynonymsMac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128062640-128118491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128084942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 340 (T340S)
Ref Sequence ENSEMBL: ENSMUSP00000101849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]
Predicted Effect probably benign
Transcript: ENSMUST00000064821
AA Change: T340S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: T340S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
AA Change: T340S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: T340S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106240
AA Change: T340S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: T340S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106242
AA Change: T340S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: T340S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120355
AA Change: T340S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: T340S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
adhesion UTSW 7 128101537 missense probably damaging 0.99
apparition UTSW 7 128112286 splice site probably null
attachment UTSW 7 128113033 missense probably damaging 1.00
Follower UTSW 7 128080264 missense probably damaging 1.00
invisible UTSW 7 128070703 unclassified probably null
obscured UTSW 7 128081634 missense probably damaging 1.00
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2105:Itgam UTSW 7 128081712 missense probably damaging 1.00
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2656:Itgam UTSW 7 128116815 missense probably null 1.00
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 unclassified probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5190:Itgam UTSW 7 128116317 unclassified probably null
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTATGTGCTACTACACCTGACC -3'
(R):5'- GGTTGCATGAGACTGAAGGA -3'

Sequencing Primer
(F):5'- GGTTAAATACCTTGAGGACCCCATTC -3'
(R):5'- GCCTCAGAATCATTATTGCTGGGAC -3'
Posted On2018-03-15