Mutagenetix > Incidental Mutations

Incidental Mutation 'R6282:Itgam'

507998

Institutional Source

Beutler Lab

Gene Symbol

Itgam

Ensembl Gene

ENSMUSG00000030786

Gene Name

integrin alpha M

Synonyms

Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R6282 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128062640-128118491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128084942 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 340 (T340S)

Ref Sequence

ENSEMBL: ENSMUSP00000101849 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]

Predicted Effect

probably benign
Transcript: ENSMUST00000064821
AA Change: T340S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: T340S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
Pfam:Integrin_alpha	1130	1144	2.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098015
AA Change: T340S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: T340S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106240
AA Change: T340S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: T340S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	462	516	3.67e-3	SMART
low complexity region	732	738	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106242
AA Change: T340S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: T340S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	8.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120355
AA Change: T340S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: T340S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
low complexity region	1141	1150	N/A	INTRINSIC

Meta Mutation Damage Score

0.0595

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,800,769	L185Q	possibly damaging	Het
Abca6	A	T	11: 110,208,824	C966S	probably damaging	Het
Atp13a4	A	T	16: 29,434,004	I708N	probably benign	Het
Axin1	C	G	17: 26,143,037	D118E	probably damaging	Het
Bace2	A	T	16: 97,415,097	I297F	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Ccdc30	T	A	4: 119,324,017	D649V	probably damaging	Het
Cd180	G	A	13: 102,693,757	A20T	possibly damaging	Het
Cdk18	T	C	1: 132,120,020	D112G	probably damaging	Het
Cuedc1	A	G	11: 88,183,402	N254S	probably damaging	Het
Dnah7a	T	C	1: 53,503,601	H2470R	probably damaging	Het
Drap1	G	A	19: 5,424,436		probably null	Het
Fam196b	A	G	11: 34,402,819	D287G	possibly damaging	Het
Fbxo5	T	A	10: 5,801,216	K257M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm12790	A	G	4: 101,967,516	V185A	possibly damaging	Het
Gm7361	A	G	5: 26,260,413	N136S	probably benign	Het
Il10ra	C	A	9: 45,260,405	C255F	probably damaging	Het
Ktn1	A	T	14: 47,663,971	N62I	probably damaging	Het
Ldb2	A	G	5: 44,532,665	L204P	probably damaging	Het
Map2k4	T	C	11: 65,707,016	T90A	possibly damaging	Het
Mettl3	A	T	14: 52,297,971	D287E	probably benign	Het
Mier2	A	G	10: 79,544,742	F278S	probably damaging	Het
Mis18bp1	A	G	12: 65,149,163	M609T	probably benign	Het
Myo1d	A	T	11: 80,557,512	V929D	probably damaging	Het
Naprt	A	T	15: 75,891,979	M364K	probably benign	Het
Nod2	T	A	8: 88,670,460	C833S	probably benign	Het
Nrip3	C	T	7: 109,763,479		probably null	Het
Ntsr2	A	G	12: 16,658,425	Y320C	probably damaging	Het
Olfr1178	C	A	2: 88,391,533	C95*	probably null	Het
Olfr555	G	A	7: 102,659,647	M275I	probably benign	Het
Olfr761	G	A	17: 37,952,424	S200F	possibly damaging	Het
Osbpl3	A	T	6: 50,348,083		probably null	Het
Pcdhb3	C	T	18: 37,301,646	R222C	probably damaging	Het
Pik3cd	G	T	4: 149,659,743	R184S	probably benign	Het
Rad50	A	T	11: 53,669,770		probably null	Het
Rad51ap2	A	T	12: 11,457,559	H494L	probably benign	Het
Rbm25	T	C	12: 83,676,089	M762T	probably damaging	Het
Sars	G	T	3: 108,428,274	S338*	probably null	Het
Usp35	T	C	7: 97,325,948	E6G	probably damaging	Het
Vash2	T	C	1: 190,960,225	Y251C	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20	T	A	12: 110,797,009		probably benign	Het
Wfdc1	G	A	8: 119,679,407	C87Y	probably damaging	Het
Zfp985	T	A	4: 147,583,348	H224Q	probably benign	Het

Other mutations in Itgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Itgam	APN	7	128085661	missense	probably damaging	1.00
IGL00983:Itgam	APN	7	128068667	missense	probably damaging	0.97
IGL01102:Itgam	APN	7	128080273	missense	possibly damaging	0.94
IGL01615:Itgam	APN	7	128116767	missense	possibly damaging	0.80
IGL01845:Itgam	APN	7	128112472	missense	probably damaging	1.00
IGL01860:Itgam	APN	7	128070943	missense	probably benign	0.03
IGL01874:Itgam	APN	7	128115166	missense	probably damaging	0.97
IGL01910:Itgam	APN	7	128083776	missense	probably damaging	1.00
IGL01994:Itgam	APN	7	128101727	missense	probably damaging	0.97
IGL02332:Itgam	APN	7	128085674	critical splice donor site	probably null
IGL02348:Itgam	APN	7	128116300	missense	possibly damaging	0.52
IGL02394:Itgam	APN	7	128084942	missense	probably benign	0.01
IGL02491:Itgam	APN	7	128116018	missense	possibly damaging	0.71
IGL02695:Itgam	APN	7	128085941	missense	possibly damaging	0.81
IGL02821:Itgam	APN	7	128076109	missense	probably damaging	0.99
IGL02970:Itgam	APN	7	128086043	missense	probably benign	0.00
IGL03145:Itgam	APN	7	128113019	missense	probably benign	0.12
adhesion	UTSW	7	128101537	missense	probably damaging	0.99
apparition	UTSW	7	128112286	splice site	probably null
attachment	UTSW	7	128113033	missense	probably damaging	1.00
Follower	UTSW	7	128080264	missense	probably damaging	1.00
invisible	UTSW	7	128070703	unclassified	probably null
obscured	UTSW	7	128081634	missense	probably damaging	1.00
R0184:Itgam	UTSW	7	128086058	missense	probably damaging	0.96
R0389:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0443:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0454:Itgam	UTSW	7	128107980	missense	probably benign	0.01
R0674:Itgam	UTSW	7	128116218	missense	possibly damaging	0.67
R0828:Itgam	UTSW	7	128116505	critical splice donor site	probably null
R0925:Itgam	UTSW	7	128112238	missense	probably benign	0.00
R1086:Itgam	UTSW	7	128080264	missense	probably damaging	1.00
R1655:Itgam	UTSW	7	128115163	missense	probably benign	0.00
R1809:Itgam	UTSW	7	128070937	missense	possibly damaging	0.62
R1823:Itgam	UTSW	7	128064732	missense	probably benign	0.04
R2105:Itgam	UTSW	7	128081712	missense	probably damaging	1.00
R2154:Itgam	UTSW	7	128085577	missense	probably damaging	0.99
R2656:Itgam	UTSW	7	128116815	missense	probably null	1.00
R2913:Itgam	UTSW	7	128112406	missense	probably damaging	1.00
R3116:Itgam	UTSW	7	128116029	missense	probably damaging	1.00
R3404:Itgam	UTSW	7	128070703	unclassified	probably null
R3821:Itgam	UTSW	7	128112286	splice site	probably null
R3822:Itgam	UTSW	7	128112286	splice site	probably null
R3960:Itgam	UTSW	7	128115175	missense	probably benign	0.02
R3968:Itgam	UTSW	7	128113033	missense	probably damaging	1.00
R4192:Itgam	UTSW	7	128064732	missense	probably benign	0.21
R4400:Itgam	UTSW	7	128081658	missense	probably damaging	1.00
R4708:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4709:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4742:Itgam	UTSW	7	128113073	missense	probably damaging	1.00
R4790:Itgam	UTSW	7	128116273	missense	probably benign	0.01
R4960:Itgam	UTSW	7	128115840	missense	possibly damaging	0.93
R5109:Itgam	UTSW	7	128113218	missense	probably benign	0.06
R5190:Itgam	UTSW	7	128116317	unclassified	probably null
R5379:Itgam	UTSW	7	128112388	missense	probably damaging	1.00
R5386:Itgam	UTSW	7	128107980	missense	probably benign	0.00
R6104:Itgam	UTSW	7	128116302	missense	possibly damaging	0.85
R6122:Itgam	UTSW	7	128085652	missense	probably damaging	0.99
R6189:Itgam	UTSW	7	128112504	missense	probably benign	0.04
R6545:Itgam	UTSW	7	128107872	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTATGTGCTACTACACCTGACC -3'
(R):5'- GGTTGCATGAGACTGAAGGA -3'

Sequencing Primer
(F):5'- GGTTAAATACCTTGAGGACCCCATTC -3'
(R):5'- GCCTCAGAATCATTATTGCTGGGAC -3'

Posted On

2018-03-15