Incidental Mutation 'R6282:Nod2'
ID507999
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88670460 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 833 (C833S)
Ref Sequence ENSEMBL: ENSMUSP00000050538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably benign
Transcript: ENSMUST00000054324
AA Change: C833S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: C833S

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109634
AA Change: C818S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: C818S

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118370
AA Change: C811S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: C811S

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124091
Meta Mutation Damage Score 0.1513 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 intron probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
R7588:Nod2 UTSW 8 88674908 missense possibly damaging 0.80
R7625:Nod2 UTSW 8 88665278 missense probably damaging 0.98
R7915:Nod2 UTSW 8 88660797 intron probably null
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTCTCTATCTGCATGAGGTAC -3'
(R):5'- TGAAGAGACTGCTGGGTTCC -3'

Sequencing Primer
(F):5'- AGGTACTCTGCCCTTCTGG -3'
(R):5'- TGGAAACAAAGCACAGGACC -3'
Posted On2018-03-15