Mutagenetix > Incidental Mutations

Incidental Mutation 'R6282:Nod2'

507999

Institutional Source

Beutler Lab

Gene Symbol

Nod2

Ensembl Gene

ENSMUSG00000055994

Gene Name

nucleotide-binding oligomerization domain containing 2

Synonyms

Nlrc2, Card15, F830032C23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R6282 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88647315-88688474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88670460 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 833 (C833S)

Ref Sequence

ENSEMBL: ENSMUSP00000050538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]

Predicted Effect

probably benign
Transcript: ENSMUST00000054324
AA Change: C833S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: C833S

Domain	Start	End	E-Value	Type
Pfam:CARD	4	92	5.3e-20	PFAM
Blast:CARD	100	177	8e-11	BLAST
Pfam:NACHT	288	458	1.8e-46	PFAM
low complexity region	521	554	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC
LRR	781	811	3.15e1	SMART
LRR	813	836	1.12e2	SMART
LRR	837	864	8.53e0	SMART
LRR	865	892	1.58e-3	SMART
LRR	893	920	4.83e-1	SMART
LRR	921	948	1.13e0	SMART
LRR	949	976	4.68e-6	SMART
LRR	977	1004	7.78e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109634
AA Change: C818S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: C818S

Domain	Start	End	E-Value	Type
Pfam:CARD	11	99	2.5e-22	PFAM
Pfam:CARD	111	195	2.1e-14	PFAM
Pfam:NACHT	273	443	1.2e-45	PFAM
low complexity region	506	539	N/A	INTRINSIC
low complexity region	613	624	N/A	INTRINSIC
LRR	766	796	3.15e1	SMART
LRR	798	821	1.12e2	SMART
LRR	822	849	8.53e0	SMART
LRR	850	877	1.58e-3	SMART
LRR	878	905	4.83e-1	SMART
LRR	906	933	1.13e0	SMART
LRR	934	961	4.68e-6	SMART
LRR	962	989	7.78e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118370
AA Change: C811S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: C811S

Domain	Start	End	E-Value	Type
Pfam:CARD	4	92	1e-21	PFAM
Pfam:CARD	104	188	8.4e-14	PFAM
Pfam:NACHT	266	436	2.5e-45	PFAM
low complexity region	499	532	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
LRR	759	789	3.15e1	SMART
LRR	791	814	1.12e2	SMART
LRR	815	842	8.53e0	SMART
LRR	843	870	1.58e-3	SMART
LRR	871	898	4.83e-1	SMART
LRR	899	926	1.13e0	SMART
LRR	927	954	4.68e-6	SMART
LRR	955	982	7.78e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124091

Meta Mutation Damage Score

0.1513

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,800,769	L185Q	possibly damaging	Het
Abca6	A	T	11: 110,208,824	C966S	probably damaging	Het
Atp13a4	A	T	16: 29,434,004	I708N	probably benign	Het
Axin1	C	G	17: 26,143,037	D118E	probably damaging	Het
Bace2	A	T	16: 97,415,097	I297F	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Ccdc30	T	A	4: 119,324,017	D649V	probably damaging	Het
Cd180	G	A	13: 102,693,757	A20T	possibly damaging	Het
Cdk18	T	C	1: 132,120,020	D112G	probably damaging	Het
Cuedc1	A	G	11: 88,183,402	N254S	probably damaging	Het
Dnah7a	T	C	1: 53,503,601	H2470R	probably damaging	Het
Drap1	G	A	19: 5,424,436		probably null	Het
Fam196b	A	G	11: 34,402,819	D287G	possibly damaging	Het
Fbxo5	T	A	10: 5,801,216	K257M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm12790	A	G	4: 101,967,516	V185A	possibly damaging	Het
Gm7361	A	G	5: 26,260,413	N136S	probably benign	Het
Il10ra	C	A	9: 45,260,405	C255F	probably damaging	Het
Itgam	A	T	7: 128,084,942	T340S	probably benign	Het
Ktn1	A	T	14: 47,663,971	N62I	probably damaging	Het
Ldb2	A	G	5: 44,532,665	L204P	probably damaging	Het
Map2k4	T	C	11: 65,707,016	T90A	possibly damaging	Het
Mettl3	A	T	14: 52,297,971	D287E	probably benign	Het
Mier2	A	G	10: 79,544,742	F278S	probably damaging	Het
Mis18bp1	A	G	12: 65,149,163	M609T	probably benign	Het
Myo1d	A	T	11: 80,557,512	V929D	probably damaging	Het
Naprt	A	T	15: 75,891,979	M364K	probably benign	Het
Nrip3	C	T	7: 109,763,479		probably null	Het
Ntsr2	A	G	12: 16,658,425	Y320C	probably damaging	Het
Olfr1178	C	A	2: 88,391,533	C95*	probably null	Het
Olfr555	G	A	7: 102,659,647	M275I	probably benign	Het
Olfr761	G	A	17: 37,952,424	S200F	possibly damaging	Het
Osbpl3	A	T	6: 50,348,083		probably null	Het
Pcdhb3	C	T	18: 37,301,646	R222C	probably damaging	Het
Pik3cd	G	T	4: 149,659,743	R184S	probably benign	Het
Rad50	A	T	11: 53,669,770		probably null	Het
Rad51ap2	A	T	12: 11,457,559	H494L	probably benign	Het
Rbm25	T	C	12: 83,676,089	M762T	probably damaging	Het
Sars	G	T	3: 108,428,274	S338*	probably null	Het
Usp35	T	C	7: 97,325,948	E6G	probably damaging	Het
Vash2	T	C	1: 190,960,225	Y251C	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20	T	A	12: 110,797,009		probably benign	Het
Wfdc1	G	A	8: 119,679,407	C87Y	probably damaging	Het
Zfp985	T	A	4: 147,583,348	H224Q	probably benign	Het

Other mutations in Nod2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01404:Nod2	APN	8	88663736	missense	probably benign	0.02
IGL02299:Nod2	APN	8	88663742	missense	possibly damaging	0.81
PIT4687001:Nod2	UTSW	8	88681646	missense	probably damaging	1.00
R0305:Nod2	UTSW	8	88665323	missense	probably damaging	1.00
R0391:Nod2	UTSW	8	88663778	missense	probably benign	0.00
R0580:Nod2	UTSW	8	88664406	missense	probably damaging	1.00
R0617:Nod2	UTSW	8	88653231	missense	probably benign	0.00
R0815:Nod2	UTSW	8	88672662	splice site	probably benign
R1460:Nod2	UTSW	8	88663812	missense	probably damaging	1.00
R1528:Nod2	UTSW	8	88664589	missense	possibly damaging	0.92
R1707:Nod2	UTSW	8	88670476	missense	possibly damaging	0.59
R1934:Nod2	UTSW	8	88663719	missense	probably benign
R1956:Nod2	UTSW	8	88664208	missense	probably damaging	1.00
R1972:Nod2	UTSW	8	88652873	missense	probably damaging	1.00
R1973:Nod2	UTSW	8	88652873	missense	probably damaging	1.00
R2902:Nod2	UTSW	8	88675463	missense	probably damaging	1.00
R2918:Nod2	UTSW	8	88652891	missense	probably benign	0.02
R3435:Nod2	UTSW	8	88664009	missense	possibly damaging	0.64
R3705:Nod2	UTSW	8	88653320	missense	probably benign	0.02
R4395:Nod2	UTSW	8	88664391	missense	probably damaging	1.00
R4612:Nod2	UTSW	8	88665036	missense	possibly damaging	0.65
R4756:Nod2	UTSW	8	88664274	missense	possibly damaging	0.59
R5122:Nod2	UTSW	8	88664120	missense	probably damaging	1.00
R5144:Nod2	UTSW	8	88653066	missense	probably damaging	0.99
R5166:Nod2	UTSW	8	88664247	missense	possibly damaging	0.58
R5203:Nod2	UTSW	8	88664451	missense	probably damaging	1.00
R5338:Nod2	UTSW	8	88672785	intron	probably null
R5614:Nod2	UTSW	8	88664196	missense	probably damaging	1.00
R5746:Nod2	UTSW	8	88664342	missense	probably damaging	0.98
R5834:Nod2	UTSW	8	88664639	missense	possibly damaging	0.91
R6059:Nod2	UTSW	8	88664414	missense	probably damaging	1.00
R6707:Nod2	UTSW	8	88665189	missense	probably benign
R6741:Nod2	UTSW	8	88653066	missense	probably damaging	0.99
R6838:Nod2	UTSW	8	88670458	missense	possibly damaging	0.63
R7008:Nod2	UTSW	8	88663657	nonsense	probably null
R7182:Nod2	UTSW	8	88663832	missense	probably benign	0.01
R7324:Nod2	UTSW	8	88653066	missense	probably damaging	1.00
R7344:Nod2	UTSW	8	88660582	missense	probably damaging	1.00
R7588:Nod2	UTSW	8	88674908	missense	possibly damaging	0.80
R7625:Nod2	UTSW	8	88665278	missense	probably damaging	0.98
R7915:Nod2	UTSW	8	88660797	intron	probably null
Z1088:Nod2	UTSW	8	88664146	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGTCTCTATCTGCATGAGGTAC -3'
(R):5'- TGAAGAGACTGCTGGGTTCC -3'

Sequencing Primer
(F):5'- AGGTACTCTGCCCTTCTGG -3'
(R):5'- TGGAAACAAAGCACAGGACC -3'

Posted On

2018-03-15