Incidental Mutation 'R6282:Il10ra'
ID508001
Institutional Source Beutler Lab
Gene Symbol Il10ra
Ensembl Gene ENSMUSG00000032089
Gene Nameinterleukin 10 receptor, alpha
SynonymsCDw210, Il10r, mIL-10R
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45253837-45269149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45260405 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 255 (C255F)
Ref Sequence ENSEMBL: ENSMUSP00000034594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034594] [ENSMUST00000176222] [ENSMUST00000176808]
Predicted Effect probably damaging
Transcript: ENSMUST00000034594
AA Change: C255F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034594
Gene: ENSMUSG00000032089
AA Change: C255F

DomainStartEndE-ValueType
Pfam:Tissue_fac 5 114 3.3e-29 PFAM
SCOP:d1lqsr2 125 231 5e-59 SMART
transmembrane domain 239 261 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176222
AA Change: C253F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135461
Gene: ENSMUSG00000032089
AA Change: C253F

DomainStartEndE-ValueType
Pfam:Tissue_fac 2 112 3.5e-26 PFAM
SCOP:d1lqsr2 123 229 5e-59 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 480 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176318
Predicted Effect probably benign
Transcript: ENSMUST00000176808
SMART Domains Protein: ENSMUSP00000135361
Gene: ENSMUSG00000032089

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for an ENU-generated null allele suffer from a severe inflammatory bowel syndrome. Mice heterozygote for an NZW variant allele have high sera levels of anti-chromatin antibodies. Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Il10ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Il10ra APN 9 45267160 missense probably damaging 1.00
IGL01916:Il10ra APN 9 45256146 missense probably damaging 1.00
IGL03067:Il10ra APN 9 45255859 missense probably benign 0.01
R0081:Il10ra UTSW 9 45255949 missense probably benign 0.04
R0266:Il10ra UTSW 9 45265652 missense probably benign 0.11
R1734:Il10ra UTSW 9 45255943 missense probably benign 0.02
R1901:Il10ra UTSW 9 45256356 missense probably benign 0.39
R1991:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2103:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2218:Il10ra UTSW 9 45265616 missense probably benign
R4686:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R4908:Il10ra UTSW 9 45255621 missense probably benign 0.21
R4982:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R5590:Il10ra UTSW 9 45265626 nonsense probably null
R5739:Il10ra UTSW 9 45256070 missense possibly damaging 0.65
R5872:Il10ra UTSW 9 45255653 missense possibly damaging 0.92
R6053:Il10ra UTSW 9 45256303 missense probably damaging 0.99
R6798:Il10ra UTSW 9 45256432 missense probably damaging 0.99
R7060:Il10ra UTSW 9 45256224 missense probably benign 0.00
R7561:Il10ra UTSW 9 45255819 missense probably benign 0.00
R7630:Il10ra UTSW 9 45256071 missense probably damaging 1.00
R7709:Il10ra UTSW 9 45260399 missense probably benign 0.01
Z1176:Il10ra UTSW 9 45266632 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCTGTGTGCATACCTGTGAATTC -3'
(R):5'- TCTAGGGCTGTGATCTTCCC -3'

Sequencing Primer
(F):5'- GTGTGCATACCTGTGAATTCACTCTG -3'
(R):5'- CATAGCCTGTGGGAATGACCTG -3'
Posted On2018-03-15