Incidental Mutation 'R6282:Fbxo5'
ID 508002
Institutional Source Beutler Lab
Gene Symbol Fbxo5
Ensembl Gene ENSMUSG00000019773
Gene Name F-box protein 5
Synonyms 2510044I10Rik, Fbxo31, Emi1
MMRRC Submission 044452-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6282 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 5749155-5755465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5751216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 257 (K257M)
Ref Sequence ENSEMBL: ENSMUSP00000019907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019907]
AlphaFold Q7TSG3
Predicted Effect probably damaging
Transcript: ENSMUST00000019907
AA Change: K257M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019907
Gene: ENSMUSG00000019773
AA Change: K257M

DomainStartEndE-ValueType
FBOX 229 270 3.2e-4 SMART
IBR 331 393 1.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142200
Meta Mutation Damage Score 0.5774 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is similar to xenopus early mitotic inhibitor-1 (Emi1), which is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation, impaired embryogenesis, and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,690,781 (GRCm39) L185Q possibly damaging Het
Abca6 A T 11: 110,099,650 (GRCm39) C966S probably damaging Het
Atp13a4 A T 16: 29,252,822 (GRCm39) I708N probably benign Het
Axin1 C G 17: 26,362,011 (GRCm39) D118E probably damaging Het
Bace2 A T 16: 97,216,297 (GRCm39) I297F probably damaging Het
Ccdc30 T A 4: 119,181,214 (GRCm39) D649V probably damaging Het
Cd180 G A 13: 102,830,265 (GRCm39) A20T possibly damaging Het
Cdk18 T C 1: 132,047,758 (GRCm39) D112G probably damaging Het
Cuedc1 A G 11: 88,074,228 (GRCm39) N254S probably damaging Het
Dnah7a T C 1: 53,542,760 (GRCm39) H2470R probably damaging Het
Drap1 G A 19: 5,474,464 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm12790 A G 4: 101,824,713 (GRCm39) V185A possibly damaging Het
Gm7361 A G 5: 26,465,411 (GRCm39) N136S probably benign Het
Il10ra C A 9: 45,171,703 (GRCm39) C255F probably damaging Het
Insyn2b A G 11: 34,352,819 (GRCm39) D287G possibly damaging Het
Itgam A T 7: 127,684,114 (GRCm39) T340S probably benign Het
Ktn1 A T 14: 47,901,428 (GRCm39) N62I probably damaging Het
Ldb2 A G 5: 44,690,007 (GRCm39) L204P probably damaging Het
Map2k4 T C 11: 65,597,842 (GRCm39) T90A possibly damaging Het
Mettl3 A T 14: 52,535,428 (GRCm39) D287E probably benign Het
Mier2 A G 10: 79,380,576 (GRCm39) F278S probably damaging Het
Mis18bp1 A G 12: 65,195,937 (GRCm39) M609T probably benign Het
Myo1d A T 11: 80,448,338 (GRCm39) V929D probably damaging Het
Naprt A T 15: 75,763,828 (GRCm39) M364K probably benign Het
Nod2 T A 8: 89,397,088 (GRCm39) C833S probably benign Het
Nrip3 C T 7: 109,362,686 (GRCm39) probably null Het
Ntsr2 A G 12: 16,708,426 (GRCm39) Y320C probably damaging Het
Or14j8 G A 17: 38,263,315 (GRCm39) S200F possibly damaging Het
Or4p7 C A 2: 88,221,877 (GRCm39) C95* probably null Het
Or51h1 G A 7: 102,308,854 (GRCm39) M275I probably benign Het
Osbpl3 A T 6: 50,325,063 (GRCm39) probably null Het
Pcdhb3 C T 18: 37,434,699 (GRCm39) R222C probably damaging Het
Pik3cd G T 4: 149,744,200 (GRCm39) R184S probably benign Het
Pramel32 T C 4: 88,548,291 (GRCm39) E38G probably damaging Het
Rad50 A T 11: 53,560,597 (GRCm39) probably null Het
Rad51ap2 A T 12: 11,507,560 (GRCm39) H494L probably benign Het
Rbm25 T C 12: 83,722,863 (GRCm39) M762T probably damaging Het
Sars1 G T 3: 108,335,590 (GRCm39) S338* probably null Het
Usp35 T C 7: 96,975,155 (GRCm39) E6G probably damaging Het
Vash2 T C 1: 190,692,422 (GRCm39) Y251C probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20 T A 12: 110,763,443 (GRCm39) probably benign Het
Wfdc1 G A 8: 120,406,146 (GRCm39) C87Y probably damaging Het
Zfp985 T A 4: 147,667,805 (GRCm39) H224Q probably benign Het
Other mutations in Fbxo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03395:Fbxo5 APN 10 5,751,935 (GRCm39) missense probably benign 0.00
R0382:Fbxo5 UTSW 10 5,751,176 (GRCm39) nonsense probably null
R4580:Fbxo5 UTSW 10 5,755,255 (GRCm39) splice site probably null
R4864:Fbxo5 UTSW 10 5,752,392 (GRCm39) missense probably benign 0.26
R5779:Fbxo5 UTSW 10 5,750,303 (GRCm39) missense possibly damaging 0.93
R7161:Fbxo5 UTSW 10 5,752,043 (GRCm39) missense possibly damaging 0.56
R9261:Fbxo5 UTSW 10 5,752,325 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGGTGTGTCTCATACAAAG -3'
(R):5'- TGGTAGTCTGGCTAAGCACTC -3'

Sequencing Primer
(F):5'- GTTCTATAGAGGATCCACACACTGCG -3'
(R):5'- GTCTGGCTAAGCACTCATAACTGG -3'
Posted On 2018-03-15