Incidental Mutation 'R6282:Abca6'
ID508010
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110208824 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 966 (C966S)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: C966S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: C966S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R8119:Abca6 UTSW 11 110197104 missense probably benign 0.00
R8139:Abca6 UTSW 11 110184133 missense probably damaging 1.00
R8176:Abca6 UTSW 11 110244194 missense probably benign 0.01
R8179:Abca6 UTSW 11 110245274 missense probably damaging 1.00
R8197:Abca6 UTSW 11 110211815 missense probably damaging 0.99
R8241:Abca6 UTSW 11 110188630 missense probably null 1.00
R8404:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8429:Abca6 UTSW 11 110202382 missense probably benign
R8502:Abca6 UTSW 11 110219319 missense probably damaging 0.99
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGTGGGTAATGTAAGCCGTC -3'
(R):5'- TGTATGAACCCATTTAGACTCCTCC -3'

Sequencing Primer
(F):5'- AGCCGTCATATTTTTAATTGTTTGG -3'
(R):5'- CGTGCGAGGTTCCTTTAT -3'
Posted On2018-03-15