Mutagenetix > Incidental Mutations

Incidental Mutation 'R6282:Ntsr2'

508012

Institutional Source

Beutler Lab

Gene Symbol

Ntsr2

Ensembl Gene

ENSMUSG00000020591

Gene Name

neurotensin receptor 2

Synonyms

NTRL, NT2R

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R6282 (G1)

Quality Score

153.008

Status

Validated

Chromosome

Chromosomal Location

16653382-16660227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16658425 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 320 (Y320C)

Ref Sequence

ENSEMBL: ENSMUSP00000106693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]

Predicted Effect

probably damaging
Transcript: ENSMUST00000111064
AA Change: Y320C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: Y320C

Domain	Start	End	E-Value	Type
Pfam:7tm_1	49	358	4.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000220892
AA Change: T260A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221049
AA Change: T215A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000221596

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222957

Meta Mutation Damage Score

0.4278

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,800,769	L185Q	possibly damaging	Het
Abca6	A	T	11: 110,208,824	C966S	probably damaging	Het
Atp13a4	A	T	16: 29,434,004	I708N	probably benign	Het
Axin1	C	G	17: 26,143,037	D118E	probably damaging	Het
Bace2	A	T	16: 97,415,097	I297F	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Ccdc30	T	A	4: 119,324,017	D649V	probably damaging	Het
Cd180	G	A	13: 102,693,757	A20T	possibly damaging	Het
Cdk18	T	C	1: 132,120,020	D112G	probably damaging	Het
Cuedc1	A	G	11: 88,183,402	N254S	probably damaging	Het
Dnah7a	T	C	1: 53,503,601	H2470R	probably damaging	Het
Drap1	G	A	19: 5,424,436		probably null	Het
Fam196b	A	G	11: 34,402,819	D287G	possibly damaging	Het
Fbxo5	T	A	10: 5,801,216	K257M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm12790	A	G	4: 101,967,516	V185A	possibly damaging	Het
Gm7361	A	G	5: 26,260,413	N136S	probably benign	Het
Il10ra	C	A	9: 45,260,405	C255F	probably damaging	Het
Itgam	A	T	7: 128,084,942	T340S	probably benign	Het
Ktn1	A	T	14: 47,663,971	N62I	probably damaging	Het
Ldb2	A	G	5: 44,532,665	L204P	probably damaging	Het
Map2k4	T	C	11: 65,707,016	T90A	possibly damaging	Het
Mettl3	A	T	14: 52,297,971	D287E	probably benign	Het
Mier2	A	G	10: 79,544,742	F278S	probably damaging	Het
Mis18bp1	A	G	12: 65,149,163	M609T	probably benign	Het
Myo1d	A	T	11: 80,557,512	V929D	probably damaging	Het
Naprt	A	T	15: 75,891,979	M364K	probably benign	Het
Nod2	T	A	8: 88,670,460	C833S	probably benign	Het
Nrip3	C	T	7: 109,763,479		probably null	Het
Olfr1178	C	A	2: 88,391,533	C95*	probably null	Het
Olfr555	G	A	7: 102,659,647	M275I	probably benign	Het
Olfr761	G	A	17: 37,952,424	S200F	possibly damaging	Het
Osbpl3	A	T	6: 50,348,083		probably null	Het
Pcdhb3	C	T	18: 37,301,646	R222C	probably damaging	Het
Pik3cd	G	T	4: 149,659,743	R184S	probably benign	Het
Rad50	A	T	11: 53,669,770		probably null	Het
Rad51ap2	A	T	12: 11,457,559	H494L	probably benign	Het
Rbm25	T	C	12: 83,676,089	M762T	probably damaging	Het
Sars	G	T	3: 108,428,274	S338*	probably null	Het
Usp35	T	C	7: 97,325,948	E6G	probably damaging	Het
Vash2	T	C	1: 190,960,225	Y251C	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20	T	A	12: 110,797,009		probably benign	Het
Wfdc1	G	A	8: 119,679,407	C87Y	probably damaging	Het
Zfp985	T	A	4: 147,583,348	H224Q	probably benign	Het

Other mutations in Ntsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Ntsr2	APN	12	16659848	missense	probably damaging	0.97
IGL01973:Ntsr2	APN	12	16656774	missense	probably benign	0.01
IGL02202:Ntsr2	APN	12	16653660	missense	probably damaging	0.99
IGL02493:Ntsr2	APN	12	16658389	missense	possibly damaging	0.90
IGL02837:Ntsr2	UTSW	12	16653875	missense	probably damaging	0.99
R0066:Ntsr2	UTSW	12	16654119	missense	probably benign	0.09
R0066:Ntsr2	UTSW	12	16654119	missense	probably benign	0.09
R0381:Ntsr2	UTSW	12	16659718	nonsense	probably null
R0437:Ntsr2	UTSW	12	16653695	missense	probably damaging	1.00
R0666:Ntsr2	UTSW	12	16653980	missense	probably benign	0.28
R0751:Ntsr2	UTSW	12	16654030	missense	probably damaging	1.00
R1919:Ntsr2	UTSW	12	16654110	missense	probably damaging	0.96
R2190:Ntsr2	UTSW	12	16654017	missense	probably damaging	1.00
R5323:Ntsr2	UTSW	12	16659933	missense	probably benign	0.00
R5358:Ntsr2	UTSW	12	16654082	missense	probably damaging	1.00
R6358:Ntsr2	UTSW	12	16656768	missense	probably benign	0.29
R6523:Ntsr2	UTSW	12	16656696	missense	probably benign	0.05
R6837:Ntsr2	UTSW	12	16659709	missense	probably benign	0.04
RF017:Ntsr2	UTSW	12	16659765	missense	probably damaging	0.99
X0064:Ntsr2	UTSW	12	16656757	missense	probably damaging	1.00
Z1177:Ntsr2	UTSW	12	16653662

Predicted Primers

PCR Primer
(F):5'- CCAAGGACATGGAAGGTTCG -3'
(R):5'- AGATTTTGAAAGTACAGCCTGAGC -3'

Sequencing Primer
(F):5'- CATCCTTTGGCTCCAGGAAGATG -3'
(R):5'- CTGAGCAGGACCGGATAGACTAC -3'

Posted On

2018-03-15