Incidental Mutation 'R6282:Rbm25'
ID508014
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83676089 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 762 (M762T)
Ref Sequence ENSEMBL: ENSMUSP00000048470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000181983] [ENSMUST00000182450]
Predicted Effect probably damaging
Transcript: ENSMUST00000048155
AA Change: M762T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: M762T

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181983
SMART Domains Protein: ENSMUSP00000138572
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
internal_repeat_1 187 203 3e-5 PROSPERO
low complexity region 234 241 N/A INTRINSIC
internal_repeat_1 258 274 3e-5 PROSPERO
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
low complexity region 575 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182450
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2336:Rbm25 UTSW 12 83651418 missense probably damaging 1.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R3971:Rbm25 UTSW 12 83675208 missense probably benign 0.03
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5909:Rbm25 UTSW 12 83681588 missense probably damaging 0.97
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6275:Rbm25 UTSW 12 83644432 missense probably damaging 0.98
R7156:Rbm25 UTSW 12 83664191 missense unknown
R7188:Rbm25 UTSW 12 83663998 missense unknown
R7217:Rbm25 UTSW 12 83664217 missense unknown
R7403:Rbm25 UTSW 12 83676134 missense probably damaging 1.00
R7508:Rbm25 UTSW 12 83672877 missense probably damaging 0.99
R7703:Rbm25 UTSW 12 83675090 missense possibly damaging 0.69
R8004:Rbm25 UTSW 12 83674392 missense possibly damaging 0.61
Z1176:Rbm25 UTSW 12 83672884 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCTGCACCGTACAACTTAATAGTC -3'
(R):5'- GCTGACTTCAAATATCAGGTCAC -3'

Sequencing Primer
(F):5'- CCATGGAAATTCAAATGGCTGTTTGG -3'
(R):5'- AAATTTTGTGTAGATGCAGG -3'
Posted On2018-03-15