Incidental Mutation 'R6282:Mettl3'
ID508017
Institutional Source Beutler Lab
Gene Symbol Mettl3
Ensembl Gene ENSMUSG00000022160
Gene Namemethyltransferase like 3
SynonymsM6A, 2310024F18Rik, Spo8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52294841-52305128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52297971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 287 (D287E)
Ref Sequence ENSEMBL: ENSMUSP00000134732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000122962] [ENSMUST00000145875] [ENSMUST00000147768] [ENSMUST00000173138] [ENSMUST00000173896] [ENSMUST00000174351] [ENSMUST00000174853]
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022767
AA Change: D338E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160
AA Change: D338E

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130550
Predicted Effect probably benign
Transcript: ENSMUST00000145875
Predicted Effect probably benign
Transcript: ENSMUST00000147768
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156611
Predicted Effect probably benign
Transcript: ENSMUST00000173138
SMART Domains Protein: ENSMUSP00000134018
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173546
Predicted Effect probably benign
Transcript: ENSMUST00000173656
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173896
SMART Domains Protein: ENSMUSP00000133506
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174351
AA Change: D287E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160
AA Change: D287E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174360
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174853
SMART Domains Protein: ENSMUSP00000133864
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 120 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 with a deficiency in adopting the epiblast egg cylinder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Mettl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Mettl3 APN 14 52296967 unclassified probably benign
IGL00508:Mettl3 APN 14 52294979 unclassified probably benign
R0417:Mettl3 UTSW 14 52296698 missense probably damaging 1.00
R1533:Mettl3 UTSW 14 52296928 missense probably benign 0.01
R2113:Mettl3 UTSW 14 52294984 makesense probably null
R3785:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R3786:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R4651:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4652:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4938:Mettl3 UTSW 14 52299727 missense probably damaging 1.00
R5462:Mettl3 UTSW 14 52299879 missense probably damaging 0.96
R6046:Mettl3 UTSW 14 52298786 missense possibly damaging 0.91
R6151:Mettl3 UTSW 14 52295020 missense probably damaging 1.00
R6169:Mettl3 UTSW 14 52298757 missense possibly damaging 0.88
R6225:Mettl3 UTSW 14 52296758 unclassified probably null
R8038:Mettl3 UTSW 14 52299964 missense not run
RF001:Mettl3 UTSW 14 52300299 missense probably benign
X0025:Mettl3 UTSW 14 52298088 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCCATCAGTAAGCCAG -3'
(R):5'- TCAAGTCTTTAGTCAGGAGAACG -3'

Sequencing Primer
(F):5'- TCCCATCAGTAAGCCAGATTGC -3'
(R):5'- CGAAAGTCCTTTAGTTTAACAATGC -3'
Posted On2018-03-15