Incidental Mutation 'R6282:Naprt'
ID508018
Institutional Source Beutler Lab
Gene Symbol Naprt
Ensembl Gene ENSMUSG00000022574
Gene Namenicotinate phosphoribosyltransferase
SynonymsNaprt1, 9130210N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location75890956-75894481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75891979 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 364 (M364K)
Ref Sequence ENSEMBL: ENSMUSP00000023237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000023237] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000137426] [ENSMUST00000141268] [ENSMUST00000144614] [ENSMUST00000151066] [ENSMUST00000154584] [ENSMUST00000184858] [ENSMUST00000229571]
Predicted Effect probably benign
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023237
AA Change: M364K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023237
Gene: ENSMUSG00000022574
AA Change: M364K

DomainStartEndE-ValueType
PDB:4MZY|A 16 522 2e-70 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000089680
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089681
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109972
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109975
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116440
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134222
Predicted Effect probably benign
Transcript: ENSMUST00000137426
SMART Domains Protein: ENSMUSP00000114753
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 53 72 N/A INTRINSIC
internal_repeat_1 160 179 9.48e-6 PROSPERO
internal_repeat_1 305 324 9.48e-6 PROSPERO
low complexity region 330 346 N/A INTRINSIC
coiled coil region 353 391 N/A INTRINSIC
EF-1_beta_acid 430 457 2.53e-4 SMART
EF1_GNE 466 552 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151066
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154584
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184858
SMART Domains Protein: ENSMUSP00000139029
Gene: ENSMUSG00000098678

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
SCOP:d1qbkb_ 366 704 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230739
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acid (NA; niacin) is converted by nicotinic acid phosphoribosyltransferase (NAPRT; EC 2.4.2.11) to NA mononucleotide (NaMN), which is then converted to NA adenine dinucleotide (NaAD), and finally to nicotinamide adenine dinucleotide (NAD), which serves as a coenzyme in cellular redox reactions and is an essential component of a variety of processes in cellular metabolism including response to stress (Hara et al., 2007).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Naprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Naprt APN 15 75893315 missense probably damaging 1.00
IGL00846:Naprt APN 15 75891788 missense probably benign 0.13
IGL01510:Naprt APN 15 75890988 utr 3 prime probably benign
IGL01834:Naprt APN 15 75893799 missense probably damaging 1.00
IGL02002:Naprt APN 15 75891372 missense probably damaging 0.98
IGL02948:Naprt APN 15 75892357 missense probably damaging 0.99
R0440:Naprt UTSW 15 75891069 splice site probably benign
R0523:Naprt UTSW 15 75892465 missense probably damaging 1.00
R0681:Naprt UTSW 15 75893632 missense probably damaging 1.00
R2114:Naprt UTSW 15 75891788 missense probably damaging 1.00
R4424:Naprt UTSW 15 75892756 splice site probably null
R5495:Naprt UTSW 15 75893847 unclassified probably null
R5886:Naprt UTSW 15 75891475 unclassified probably null
R6166:Naprt UTSW 15 75891477 missense possibly damaging 0.94
R7167:Naprt UTSW 15 75892612 missense probably damaging 1.00
R7472:Naprt UTSW 15 75891758 intron probably null
X0018:Naprt UTSW 15 75892357 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATAGAAGGCTGTTTGGGAC -3'
(R):5'- GGCAATTGAGAAAGCCCTGG -3'

Sequencing Primer
(F):5'- GAAGTGACAGTGACACTGA -3'
(R):5'- ATAGGACCACTAGGGGGCC -3'
Posted On2018-03-15