Incidental Mutation 'R6282:Axin1'
ID508022
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 26143037 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 118 (D118E)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: D118E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: D118E

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: D118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: D118E

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: D118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: D118E

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGAGGCCTGTCAACCAC -3'
(R):5'- GTCCTTTATGAAGCTCTTAGTGGC -3'

Sequencing Primer
(F):5'- CAACCACAGTTTCTGTTCTGGGAAAG -3'
(R):5'- AAGCTCTTAGTGGCTGGCTTG -3'
Posted On2018-03-15