Incidental Mutation 'R6282:Olfr761'
ID508023
Institutional Source Beutler Lab
Gene Symbol Olfr761
Ensembl Gene ENSMUSG00000109376
Gene Nameolfactory receptor 761
SynonymsMOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37952051-37953079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37952424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 200 (S200F)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049620
AA Change: S200F

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: S200F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172723
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Olfr761
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Olfr761 APN 17 37952851 missense probably damaging 1.00
IGL02104:Olfr761 APN 17 37952291 missense probably damaging 1.00
IGL02431:Olfr761 APN 17 37952522 missense probably benign 0.06
IGL02649:Olfr761 APN 17 37952973 missense probably damaging 1.00
IGL03109:Olfr761 APN 17 37952487 missense probably damaging 1.00
IGL03261:Olfr761 APN 17 37952806 missense possibly damaging 0.76
R0898:Olfr761 UTSW 17 37952236 missense probably benign 0.17
R1373:Olfr761 UTSW 17 37952360 missense probably damaging 1.00
R1527:Olfr761 UTSW 17 37952829 missense possibly damaging 0.88
R1664:Olfr761 UTSW 17 37952893 missense probably benign 0.44
R1835:Olfr761 UTSW 17 37952385 missense possibly damaging 0.79
R4124:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4125:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4128:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4534:Olfr761 UTSW 17 37952722 missense probably benign
R4557:Olfr761 UTSW 17 37952251 missense probably benign 0.10
R4790:Olfr761 UTSW 17 37952742 missense probably damaging 0.99
R4856:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4886:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4955:Olfr761 UTSW 17 37952898 missense probably damaging 1.00
R5162:Olfr761 UTSW 17 37952364 missense probably benign 0.00
R6016:Olfr761 UTSW 17 37952076 missense probably benign 0.13
R7018:Olfr761 UTSW 17 37952502 missense probably damaging 1.00
R7199:Olfr761 UTSW 17 37952157 missense probably damaging 1.00
R7340:Olfr761 UTSW 17 37952522 missense probably benign 0.06
R7360:Olfr761 UTSW 17 37953009 missense probably damaging 1.00
R7464:Olfr761 UTSW 17 37952280 missense probably damaging 1.00
X0064:Olfr761 UTSW 17 37952814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTTGGTGAGTCTGAG -3'
(R):5'- AGTCCCAGAAAGTGCACTTGG -3'

Sequencing Primer
(F):5'- TGGCTTTAGATAGGCACAACTGC -3'
(R):5'- CAGAAAGTGCACTTGGGCTGTG -3'
Posted On2018-03-15