Incidental Mutation 'R6283:Olfr1032'
ID 508030
Institutional Source Beutler Lab
Gene Symbol Olfr1032
Ensembl Gene ENSMUSG00000042796
Gene Name olfactory receptor 1032
Synonyms GA_x6K02T2Q125-47485813-47486745, MOR199-1
MMRRC Submission 044453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6283 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86005540-86009125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86008099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 108 (V108L)
Ref Sequence ENSEMBL: ENSMUSP00000107216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]
AlphaFold A2ATE5
Predicted Effect possibly damaging
Transcript: ENSMUST00000062166
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.6e-50 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079298
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111589
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 (GRCm38) R14* probably null Het
Acsf3 C A 8: 122,785,955 (GRCm38) R372S probably damaging Het
Adamts20 A G 15: 94,351,721 (GRCm38) S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 (GRCm38) L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 (GRCm38) E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 (GRCm38) R257* probably null Het
Cd209e G A 8: 3,849,212 (GRCm38) Q167* probably null Het
Cd300e G A 11: 115,054,554 (GRCm38) T138I probably benign Het
Ces2c A T 8: 104,849,699 (GRCm38) M115L probably benign Het
Cfap61 T A 2: 146,129,102 (GRCm38) probably null Het
Chd1l G A 3: 97,587,167 (GRCm38) A399V probably damaging Het
Cic C T 7: 25,286,034 (GRCm38) S301L probably damaging Het
Cks2 A G 13: 51,645,459 (GRCm38) H16R probably benign Het
Copa A T 1: 172,118,848 (GRCm38) H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 (GRCm38) V145A possibly damaging Het
Cyp2j13 A G 4: 96,056,837 (GRCm38) V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 (GRCm38) V404A probably benign Het
Dock2 T C 11: 34,707,325 (GRCm38) S340G probably damaging Het
Ggps1 A G 13: 14,057,794 (GRCm38) probably null Het
Gm10549 C A 18: 33,464,305 (GRCm38) probably benign Het
Gm11444 T C 11: 85,846,791 (GRCm38) probably null Het
Gm853 A G 4: 130,221,741 (GRCm38) S5P probably benign Het
Grina A G 15: 76,248,551 (GRCm38) T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 (GRCm38) T223I probably benign Het
Igsf10 T A 3: 59,319,449 (GRCm38) T2268S probably damaging Het
Ino80d C T 1: 63,062,126 (GRCm38) R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 (GRCm38) T94M probably damaging Het
Itga2 A G 13: 114,869,250 (GRCm38) Y465H probably damaging Het
Knl1 A G 2: 119,070,286 (GRCm38) T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 (GRCm38) S180P unknown Het
Lpar6 A T 14: 73,238,857 (GRCm38) D86V probably damaging Het
Muc5ac C A 7: 141,816,864 (GRCm38) C2500* probably null Het
Mzf1 T C 7: 13,053,369 (GRCm38) probably benign Het
Olfr1176 T A 2: 88,339,658 (GRCm38) I31N probably benign Het
Olfr1311 A C 2: 112,021,260 (GRCm38) M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 (GRCm38) V163A probably benign Het
Otogl T G 10: 107,790,500 (GRCm38) E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 (GRCm38) S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 (GRCm38) Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 (GRCm38) I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 (GRCm38) N152T probably benign Het
Prr14l T C 5: 32,830,264 (GRCm38) E629G probably benign Het
Qpctl T A 7: 19,148,420 (GRCm38) I104F probably benign Het
Rabep1 C T 11: 70,917,679 (GRCm38) A444V probably damaging Het
Rnf150 A G 8: 82,990,554 (GRCm38) Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 (GRCm38) V152G probably damaging Het
Swt1 A G 1: 151,384,333 (GRCm38) S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 (GRCm38) T1711A probably benign Het
Tfap2d G C 1: 19,104,478 (GRCm38) G52R probably benign Het
Tmem265 T G 7: 127,564,872 (GRCm38) V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 (GRCm38) H551Y probably benign Het
Ttc6 T G 12: 57,702,262 (GRCm38) Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 (GRCm38) Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 (GRCm38) N549S possibly damaging Het
Vmn2r73 C T 7: 85,871,841 (GRCm38) M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 (GRCm38) M120K probably benign Het
Zfp804b T A 5: 6,769,908 (GRCm38) I1016F probably benign Het
Zfp90 T C 8: 106,425,394 (GRCm38) C580R probably damaging Het
Other mutations in Olfr1032
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1032 APN 2 86,008,547 (GRCm38) missense probably damaging 1.00
IGL03110:Olfr1032 APN 2 86,008,598 (GRCm38) missense probably damaging 0.99
IGL03167:Olfr1032 APN 2 86,008,167 (GRCm38) nonsense probably null
R0206:Olfr1032 UTSW 2 86,008,292 (GRCm38) missense probably damaging 1.00
R0206:Olfr1032 UTSW 2 86,008,292 (GRCm38) missense probably damaging 1.00
R0919:Olfr1032 UTSW 2 86,008,640 (GRCm38) missense possibly damaging 0.52
R2018:Olfr1032 UTSW 2 86,008,223 (GRCm38) missense probably damaging 1.00
R2019:Olfr1032 UTSW 2 86,008,223 (GRCm38) missense probably damaging 1.00
R2938:Olfr1032 UTSW 2 86,008,013 (GRCm38) missense probably damaging 0.97
R3843:Olfr1032 UTSW 2 86,008,204 (GRCm38) missense probably benign 0.09
R4295:Olfr1032 UTSW 2 86,008,270 (GRCm38) missense probably benign 0.01
R5813:Olfr1032 UTSW 2 86,008,292 (GRCm38) missense probably damaging 1.00
R7031:Olfr1032 UTSW 2 86,008,595 (GRCm38) missense probably benign 0.26
R7427:Olfr1032 UTSW 2 86,008,219 (GRCm38) missense probably benign 0.00
R7428:Olfr1032 UTSW 2 86,008,219 (GRCm38) missense probably benign 0.00
R7856:Olfr1032 UTSW 2 86,008,296 (GRCm38) missense probably damaging 0.99
R8048:Olfr1032 UTSW 2 86,008,180 (GRCm38) missense probably damaging 0.96
R8504:Olfr1032 UTSW 2 86,007,805 (GRCm38) missense probably damaging 0.99
R9129:Olfr1032 UTSW 2 86,008,012 (GRCm38) missense
R9150:Olfr1032 UTSW 2 86,008,282 (GRCm38) nonsense probably null
R9180:Olfr1032 UTSW 2 86,007,981 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGGTGGGCAACATTGG -3'
(R):5'- GTTTTCCCACAGAAGTACAAGC -3'

Sequencing Primer
(F):5'- TTAAGATCAGTCCACAGCTCAG -3'
(R):5'- GCCATAAGTCCATAAGGTTGC -3'
Posted On 2018-03-15