Incidental Mutation 'R6283:Olfr1032'
ID 508030
Institutional Source Beutler Lab
Gene Symbol Olfr1032
Ensembl Gene ENSMUSG00000042796
Gene Name olfactory receptor 1032
Synonyms GA_x6K02T2Q125-47485813-47486745, MOR199-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6283 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86005540-86009125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86008099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 108 (V108L)
Ref Sequence ENSEMBL: ENSMUSP00000107216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]
AlphaFold A2ATE5
Predicted Effect possibly damaging
Transcript: ENSMUST00000062166
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.6e-50 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079298
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111589
AA Change: V108L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: V108L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 V145A possibly damaging Het
Cyp2j13 A G 4: 96,056,837 V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r73 C T 7: 85,871,841 M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Olfr1032
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1032 APN 2 86008547 missense probably damaging 1.00
IGL03110:Olfr1032 APN 2 86008598 missense probably damaging 0.99
IGL03167:Olfr1032 APN 2 86008167 nonsense probably null
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0919:Olfr1032 UTSW 2 86008640 missense possibly damaging 0.52
R2018:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2019:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2938:Olfr1032 UTSW 2 86008013 missense probably damaging 0.97
R3843:Olfr1032 UTSW 2 86008204 missense probably benign 0.09
R4295:Olfr1032 UTSW 2 86008270 missense probably benign 0.01
R5813:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R7031:Olfr1032 UTSW 2 86008595 missense probably benign 0.26
R7427:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7428:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7856:Olfr1032 UTSW 2 86008296 missense probably damaging 0.99
R8048:Olfr1032 UTSW 2 86008180 missense probably damaging 0.96
R8504:Olfr1032 UTSW 2 86007805 missense probably damaging 0.99
R9129:Olfr1032 UTSW 2 86008012 missense
R9150:Olfr1032 UTSW 2 86008282 nonsense probably null
R9180:Olfr1032 UTSW 2 86007981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGGTGGGCAACATTGG -3'
(R):5'- GTTTTCCCACAGAAGTACAAGC -3'

Sequencing Primer
(F):5'- TTAAGATCAGTCCACAGCTCAG -3'
(R):5'- GCCATAAGTCCATAAGGTTGC -3'
Posted On 2018-03-15