Incidental Mutation 'R6283:Pcdh10'
ID508034
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R6283 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45381554 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 768 (S768T)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably benign
Transcript: ENSMUST00000166126
AA Change: S768T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: S768T

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170695
AA Change: S768T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: S768T

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171554
AA Change: S768T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: S768T

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect possibly damaging
Transcript: ENSMUST00000193252
AA Change: S768T

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: S768T

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 V145A possibly damaging Het
Cyp2j13 A G 4: 96,056,837 V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1032 G T 2: 86,008,099 V108L possibly damaging Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r73 C T 7: 85,871,841 M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACTTCACTGGACCTCACACTTATC -3'
(R):5'- TCAGCATCTGTACTCCGGGAAG -3'

Sequencing Primer
(F):5'- ATCCTTATCATCGCCCTGGG -3'
(R):5'- TTCAGGAACATCAGGTCGGTC -3'
Posted On2018-03-15