Incidental Mutation 'R6283:Cyp2j13'
ID508038
Institutional Source Beutler Lab
Gene Symbol Cyp2j13
Ensembl Gene ENSMUSG00000028571
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6283 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location96027534-96077546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96056837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000095587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030305] [ENSMUST00000097973] [ENSMUST00000107078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030305
AA Change: V377A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030305
Gene: ENSMUSG00000028571
AA Change: V377A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 6.7e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097973
AA Change: V377A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095587
Gene: ENSMUSG00000028571
AA Change: V377A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 404 8.9e-97 PFAM
low complexity region 411 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107078
AA Change: V318A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102693
Gene: ENSMUSG00000028571
AA Change: V318A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 231 2.5e-39 PFAM
Pfam:p450 218 345 8.6e-41 PFAM
low complexity region 352 361 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132513
AA Change: V132A
SMART Domains Protein: ENSMUSP00000121962
Gene: ENSMUSG00000028571
AA Change: V132A

DomainStartEndE-ValueType
Pfam:p450 1 156 2.1e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 V145A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1032 G T 2: 86,008,099 V108L possibly damaging Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r73 C T 7: 85,871,841 M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Cyp2j13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Cyp2j13 APN 4 96062038 missense probably damaging 1.00
IGL01511:Cyp2j13 APN 4 96077315 missense possibly damaging 0.79
IGL01540:Cyp2j13 APN 4 96068722 splice site probably benign
IGL01923:Cyp2j13 APN 4 96062057 missense probably benign 0.00
IGL03124:Cyp2j13 APN 4 96061922 missense possibly damaging 0.78
IGL03389:Cyp2j13 APN 4 96068321 missense probably damaging 1.00
R0671:Cyp2j13 UTSW 4 96071695 missense probably damaging 0.97
R1351:Cyp2j13 UTSW 4 96056918 missense probably benign 0.00
R1510:Cyp2j13 UTSW 4 96061972 missense possibly damaging 0.48
R1708:Cyp2j13 UTSW 4 96062067 missense probably damaging 0.99
R2327:Cyp2j13 UTSW 4 96059107 missense possibly damaging 0.50
R3834:Cyp2j13 UTSW 4 96056557 critical splice donor site probably null
R4643:Cyp2j13 UTSW 4 96056924 missense possibly damaging 0.62
R4867:Cyp2j13 UTSW 4 96058998 missense possibly damaging 0.68
R4900:Cyp2j13 UTSW 4 96059043 missense probably damaging 1.00
R5175:Cyp2j13 UTSW 4 96068215 missense possibly damaging 0.55
R5291:Cyp2j13 UTSW 4 96068329 missense probably damaging 1.00
R5770:Cyp2j13 UTSW 4 96077432 missense probably benign 0.23
R5837:Cyp2j13 UTSW 4 96071682 missense probably damaging 0.98
R5912:Cyp2j13 UTSW 4 96056842 missense probably damaging 1.00
R6362:Cyp2j13 UTSW 4 96071695 missense probably damaging 0.97
R6627:Cyp2j13 UTSW 4 96059106 missense probably damaging 0.96
R7001:Cyp2j13 UTSW 4 96056875 missense probably damaging 1.00
R7356:Cyp2j13 UTSW 4 96077418 missense probably benign 0.23
R7620:Cyp2j13 UTSW 4 96056662 missense probably benign 0.25
R8717:Cyp2j13 UTSW 4 96045540 missense probably benign 0.06
R8810:Cyp2j13 UTSW 4 96056916 missense probably benign 0.30
R8850:Cyp2j13 UTSW 4 96068191 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGTGCAGTCAAATTGGTCATG -3'
(R):5'- CACAATCAAGATGCTGGGTG -3'

Sequencing Primer
(F):5'- GTCATGACCACAGACCGCTAGG -3'
(R):5'- GCAAAGACGTTTGGAAGACAATTTC -3'
Posted On2018-03-15