Incidental Mutation 'R6283:Vmn2r73'
ID508048
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6283 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85871841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 306 (M306I)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: M306I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: M306I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Ctdsp2 T C 10: 126,995,880 V145A possibly damaging Het
Cyp2j13 A G 4: 96,056,837 V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1032 G T 2: 86,008,099 V108L possibly damaging Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
G1Funyon:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R8263:Vmn2r73 UTSW 7 85858411 missense probably benign
R8301:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R8341:Vmn2r73 UTSW 7 85857920 missense probably benign 0.01
R8500:Vmn2r73 UTSW 7 85870430 missense probably benign 0.01
R8673:Vmn2r73 UTSW 7 85872694 missense probably benign 0.01
R8719:Vmn2r73 UTSW 7 85871887 missense probably damaging 0.96
R8783:Vmn2r73 UTSW 7 85858460 missense probably damaging 0.96
R8828:Vmn2r73 UTSW 7 85871971 missense probably damaging 0.98
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGGACAATTCTTCAGTTTCTTAC -3'
(R):5'- ATCCAAACTGATGATATCACGGC -3'

Sequencing Primer
(F):5'- CAGTTTCTTACAATTAGATGGTGGC -3'
(R):5'- CTGATGATATCACGGCATATAAAGAG -3'
Posted On2018-03-15