Incidental Mutation 'R6283:Inpp4b'
ID 508055
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission 044453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R6283 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82497462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 94 (T94M)
Ref Sequence ENSEMBL: ENSMUSP00000150541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000213285] [ENSMUST00000172031] [ENSMUST00000215332] [ENSMUST00000217122]
AlphaFold Q6P1Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: T94M

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: T94M

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164870
Predicted Effect probably damaging
Transcript: ENSMUST00000169116
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: T94M

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000169387
Predicted Effect probably benign
Transcript: ENSMUST00000170160
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213285
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: T94M

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: T94M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216036
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 C A 8: 123,512,694 (GRCm39) R372S probably damaging Het
Adamts20 A G 15: 94,249,602 (GRCm39) S472P probably benign Het
Bhlhe40 T C 6: 108,641,992 (GRCm39) L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 (GRCm39) E305G possibly damaging Het
Ccdc83 T A 7: 89,885,615 (GRCm39) R257* probably null Het
Cd209e G A 8: 3,899,212 (GRCm39) Q167* probably null Het
Cd300e G A 11: 114,945,380 (GRCm39) T138I probably benign Het
Ces2c A T 8: 105,576,331 (GRCm39) M115L probably benign Het
Cfap61 T A 2: 145,971,022 (GRCm39) probably null Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Cic C T 7: 24,985,459 (GRCm39) S301L probably damaging Het
Cks2 A G 13: 51,799,495 (GRCm39) H16R probably benign Het
Copa A T 1: 171,946,415 (GRCm39) H953L possibly damaging Het
Ctdsp2 T C 10: 126,831,749 (GRCm39) V145A possibly damaging Het
Cyp2j13 A G 4: 95,945,074 (GRCm39) V377A possibly damaging Het
Dhx57 A G 17: 80,582,234 (GRCm39) V404A probably benign Het
Dock2 T C 11: 34,598,152 (GRCm39) S340G probably damaging Het
Ggps1 A G 13: 14,232,379 (GRCm39) probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11444 T C 11: 85,737,617 (GRCm39) probably null Het
Grina A G 15: 76,132,751 (GRCm39) T173A possibly damaging Het
Hcrtr1 G A 4: 130,029,133 (GRCm39) T223I probably benign Het
Igsf10 T A 3: 59,226,870 (GRCm39) T2268S probably damaging Het
Inhca G A 9: 103,159,834 (GRCm39) R14* probably null Het
Ino80d C T 1: 63,101,285 (GRCm39) R447Q probably damaging Het
Itga2 A G 13: 115,005,786 (GRCm39) Y465H probably damaging Het
Knl1 A G 2: 118,900,767 (GRCm39) T823A probably damaging Het
Krtap4-16 A G 11: 99,741,861 (GRCm39) S180P unknown Het
Ldc1 A G 4: 130,115,534 (GRCm39) S5P probably benign Het
Lpar6 A T 14: 73,476,297 (GRCm39) D86V probably damaging Het
Muc5ac C A 7: 141,370,601 (GRCm39) C2500* probably null Het
Mzf1 T C 7: 12,787,296 (GRCm39) probably benign Het
Or4f58 A C 2: 111,851,605 (GRCm39) M198R possibly damaging Het
Or5d46 T A 2: 88,170,002 (GRCm39) I31N probably benign Het
Or5m3 G T 2: 85,838,443 (GRCm39) V108L possibly damaging Het
Or7a36 T C 10: 78,820,113 (GRCm39) V163A probably benign Het
Otogl T G 10: 107,626,361 (GRCm39) E1501A probably damaging Het
Pcdh10 T A 3: 45,335,989 (GRCm39) S768T possibly damaging Het
Pcnx2 G T 8: 126,604,325 (GRCm39) Q644K probably damaging Het
Pdzd9 T A 7: 120,259,449 (GRCm39) I180F possibly damaging Het
Pinx1 A C 14: 64,115,621 (GRCm39) N152T probably benign Het
Prr14l T C 5: 32,987,608 (GRCm39) E629G probably benign Het
Qpctl T A 7: 18,882,345 (GRCm39) I104F probably benign Het
Rabep1 C T 11: 70,808,505 (GRCm39) A444V probably damaging Het
Rnf150 A G 8: 83,717,183 (GRCm39) Y230C probably damaging Het
Slc25a27 A C 17: 43,968,621 (GRCm39) V152G probably damaging Het
Swt1 A G 1: 151,260,084 (GRCm39) S772P possibly damaging Het
Tenm4 A G 7: 96,523,701 (GRCm39) T1711A probably benign Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Tmem265 T G 7: 127,164,044 (GRCm39) V86G possibly damaging Het
Trpm8 C T 1: 88,276,054 (GRCm39) H551Y probably benign Het
Ttc6 T G 12: 57,749,048 (GRCm39) Y1327D possibly damaging Het
Uevld G T 7: 46,587,729 (GRCm39) Q324K possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r73 C T 7: 85,521,049 (GRCm39) M306I probably benign Het
Vmn2r93 T A 17: 18,524,366 (GRCm39) M120K probably benign Het
Zfp804b T A 5: 6,819,908 (GRCm39) I1016F probably benign Het
Zfp90 T C 8: 107,152,026 (GRCm39) C580R probably damaging Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1754:Inpp4b UTSW 8 82,497,440 (GRCm39) missense probably damaging 1.00
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82,775,118 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6186:Inpp4b UTSW 8 82,772,863 (GRCm39) missense probably damaging 0.99
R6213:Inpp4b UTSW 8 82,724,019 (GRCm39) missense probably damaging 1.00
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9390:Inpp4b UTSW 8 82,497,522 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AATACAATGGGGCTCTGGGC -3'
(R):5'- ACGTAGAAAAGTGCACTCATAAGAC -3'

Sequencing Primer
(F):5'- GCTCATGGCCCACAAGTAAC -3'
(R):5'- GCCCTCTTTAAAAATGCCAGTAG -3'
Posted On 2018-03-15