Incidental Mutation 'R6283:Ctdsp2'
ID508064
Institutional Source Beutler Lab
Gene Symbol Ctdsp2
Ensembl Gene ENSMUSG00000078429
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
SynonymsOS4, SCP2, D10Ertd73e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R6283 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location126978717-126999975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126995880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000100891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000105255] [ENSMUST00000105256] [ENSMUST00000142698]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102105
Predicted Effect probably benign
Transcript: ENSMUST00000105255
SMART Domains Protein: ENSMUSP00000100890
Gene: ENSMUSG00000078429

DomainStartEndE-ValueType
CPDc 1 91 3.33e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105256
AA Change: V145A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100891
Gene: ENSMUSG00000078429
AA Change: V145A

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
CPDc 99 242 1.45e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142698
SMART Domains Protein: ENSMUSP00000117667
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
SCOP:d1d4xg_ 5 53 2e-17 SMART
PDB:2VIL|A 14 53 2e-14 PDB
Blast:GEL 14 54 7e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,282,635 R14* probably null Het
Acsf3 C A 8: 122,785,955 R372S probably damaging Het
Adamts20 A G 15: 94,351,721 S472P probably benign Het
Bhlhe40 T C 6: 108,665,031 L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 E305G possibly damaging Het
Ccdc83 T A 7: 90,236,407 R257* probably null Het
Cd209e G A 8: 3,849,212 Q167* probably null Het
Cd300e G A 11: 115,054,554 T138I probably benign Het
Ces2c A T 8: 104,849,699 M115L probably benign Het
Cfap61 T A 2: 146,129,102 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cks2 A G 13: 51,645,459 H16R probably benign Het
Copa A T 1: 172,118,848 H953L possibly damaging Het
Cyp2j13 A G 4: 96,056,837 V377A possibly damaging Het
Dhx57 A G 17: 80,274,805 V404A probably benign Het
Dock2 T C 11: 34,707,325 S340G probably damaging Het
Ggps1 A G 13: 14,057,794 probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11444 T C 11: 85,846,791 probably null Het
Gm853 A G 4: 130,221,741 S5P probably benign Het
Grina A G 15: 76,248,551 T173A possibly damaging Het
Hcrtr1 G A 4: 130,135,340 T223I probably benign Het
Igsf10 T A 3: 59,319,449 T2268S probably damaging Het
Ino80d C T 1: 63,062,126 R447Q probably damaging Het
Inpp4b C T 8: 81,770,833 T94M probably damaging Het
Itga2 A G 13: 114,869,250 Y465H probably damaging Het
Knl1 A G 2: 119,070,286 T823A probably damaging Het
Krtap4-16 A G 11: 99,851,035 S180P unknown Het
Lpar6 A T 14: 73,238,857 D86V probably damaging Het
Muc5ac C A 7: 141,816,864 C2500* probably null Het
Mzf1 T C 7: 13,053,369 probably benign Het
Olfr1032 G T 2: 86,008,099 V108L possibly damaging Het
Olfr1176 T A 2: 88,339,658 I31N probably benign Het
Olfr1311 A C 2: 112,021,260 M198R possibly damaging Het
Olfr1352 T C 10: 78,984,279 V163A probably benign Het
Otogl T G 10: 107,790,500 E1501A probably damaging Het
Pcdh10 T A 3: 45,381,554 S768T possibly damaging Het
Pcnx2 G T 8: 125,877,586 Q644K probably damaging Het
Pdzd9 T A 7: 120,660,226 I180F possibly damaging Het
Pinx1 A C 14: 63,878,172 N152T probably benign Het
Prr14l T C 5: 32,830,264 E629G probably benign Het
Qpctl T A 7: 19,148,420 I104F probably benign Het
Rabep1 C T 11: 70,917,679 A444V probably damaging Het
Rnf150 A G 8: 82,990,554 Y230C probably damaging Het
Slc25a27 A C 17: 43,657,730 V152G probably damaging Het
Swt1 A G 1: 151,384,333 S772P possibly damaging Het
Tenm4 A G 7: 96,874,494 T1711A probably benign Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tmem265 T G 7: 127,564,872 V86G possibly damaging Het
Trpm8 C T 1: 88,348,332 H551Y probably benign Het
Ttc6 T G 12: 57,702,262 Y1327D possibly damaging Het
Uevld G T 7: 46,937,981 Q324K possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r73 C T 7: 85,871,841 M306I probably benign Het
Vmn2r93 T A 17: 18,304,104 M120K probably benign Het
Zfp804b T A 5: 6,769,908 I1016F probably benign Het
Zfp90 T C 8: 106,425,394 C580R probably damaging Het
Other mutations in Ctdsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Ctdsp2 APN 10 126993874 missense probably benign 0.08
IGL02327:Ctdsp2 APN 10 126996382 missense probably benign 0.26
IGL03283:Ctdsp2 APN 10 126996397 missense probably benign 0.00
R1463:Ctdsp2 UTSW 10 126993921 splice site probably benign
R4724:Ctdsp2 UTSW 10 126993069 missense probably damaging 0.99
R5327:Ctdsp2 UTSW 10 126996054 missense probably damaging 1.00
R5385:Ctdsp2 UTSW 10 126996457 missense probably benign
R5994:Ctdsp2 UTSW 10 126995820 unclassified probably benign
R8558:Ctdsp2 UTSW 10 126993877 missense probably damaging 1.00
Z1177:Ctdsp2 UTSW 10 126996072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACATGGTAGAGCTGTCCATGG -3'
(R):5'- TTGACATAGCAGCCCTGGTG -3'

Sequencing Primer
(F):5'- TCCATGGTGGGGCAGAG -3'
(R):5'- CAAGCCTCTCGGAACAGG -3'
Posted On2018-03-15