Mutagenetix > Incidental Mutation

Incidental Mutation 'R6283:Dhx57'

508081

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R6283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80274805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 404 (V404A)

Ref Sequence

ENSEMBL: ENSMUSP00000041069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably benign
Transcript: ENSMUST00000038166
AA Change: V404A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V404A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086555
AA Change: V457A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V457A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Meta Mutation Damage Score

0.0612

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (59/59)

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,282,635	R14*	probably null	Het
Acsf3	C	A	8: 122,785,955	R372S	probably damaging	Het
Adamts20	A	G	15: 94,351,721	S472P	probably benign	Het
Bhlhe40	T	C	6: 108,665,031	L312P	probably damaging	Het
Ccdc180	A	G	4: 45,902,486	E305G	possibly damaging	Het
Ccdc83	T	A	7: 90,236,407	R257*	probably null	Het
Cd209e	G	A	8: 3,849,212	Q167*	probably null	Het
Cd300e	G	A	11: 115,054,554	T138I	probably benign	Het
Ces2c	A	T	8: 104,849,699	M115L	probably benign	Het
Cfap61	T	A	2: 146,129,102		probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	T	7: 25,286,034	S301L	probably damaging	Het
Cks2	A	G	13: 51,645,459	H16R	probably benign	Het
Copa	A	T	1: 172,118,848	H953L	possibly damaging	Het
Ctdsp2	T	C	10: 126,995,880	V145A	possibly damaging	Het
Cyp2j13	A	G	4: 96,056,837	V377A	possibly damaging	Het
Dock2	T	C	11: 34,707,325	S340G	probably damaging	Het
Ggps1	A	G	13: 14,057,794		probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11444	T	C	11: 85,846,791		probably null	Het
Gm853	A	G	4: 130,221,741	S5P	probably benign	Het
Grina	A	G	15: 76,248,551	T173A	possibly damaging	Het
Hcrtr1	G	A	4: 130,135,340	T223I	probably benign	Het
Igsf10	T	A	3: 59,319,449	T2268S	probably damaging	Het
Ino80d	C	T	1: 63,062,126	R447Q	probably damaging	Het
Inpp4b	C	T	8: 81,770,833	T94M	probably damaging	Het
Itga2	A	G	13: 114,869,250	Y465H	probably damaging	Het
Knl1	A	G	2: 119,070,286	T823A	probably damaging	Het
Krtap4-16	A	G	11: 99,851,035	S180P	unknown	Het
Lpar6	A	T	14: 73,238,857	D86V	probably damaging	Het
Muc5ac	C	A	7: 141,816,864	C2500*	probably null	Het
Mzf1	T	C	7: 13,053,369		probably benign	Het
Olfr1032	G	T	2: 86,008,099	V108L	possibly damaging	Het
Olfr1176	T	A	2: 88,339,658	I31N	probably benign	Het
Olfr1311	A	C	2: 112,021,260	M198R	possibly damaging	Het
Olfr1352	T	C	10: 78,984,279	V163A	probably benign	Het
Otogl	T	G	10: 107,790,500	E1501A	probably damaging	Het
Pcdh10	T	A	3: 45,381,554	S768T	possibly damaging	Het
Pcnx2	G	T	8: 125,877,586	Q644K	probably damaging	Het
Pdzd9	T	A	7: 120,660,226	I180F	possibly damaging	Het
Pinx1	A	C	14: 63,878,172	N152T	probably benign	Het
Prr14l	T	C	5: 32,830,264	E629G	probably benign	Het
Qpctl	T	A	7: 19,148,420	I104F	probably benign	Het
Rabep1	C	T	11: 70,917,679	A444V	probably damaging	Het
Rnf150	A	G	8: 82,990,554	Y230C	probably damaging	Het
Slc25a27	A	C	17: 43,657,730	V152G	probably damaging	Het
Swt1	A	G	1: 151,384,333	S772P	possibly damaging	Het
Tenm4	A	G	7: 96,874,494	T1711A	probably benign	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Tmem265	T	G	7: 127,564,872	V86G	possibly damaging	Het
Trpm8	C	T	1: 88,348,332	H551Y	probably benign	Het
Ttc6	T	G	12: 57,702,262	Y1327D	possibly damaging	Het
Uevld	G	T	7: 46,937,981	Q324K	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r73	C	T	7: 85,871,841	M306I	probably benign	Het
Vmn2r93	T	A	17: 18,304,104	M120K	probably benign	Het
Zfp804b	T	A	5: 6,769,908	I1016F	probably benign	Het
Zfp90	T	C	8: 106,425,394	C580R	probably damaging	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTCATAGTTACAGGCAGGCAC -3'
(R):5'- TCTGAGTTCCTTTATGGCAAGG -3'

Sequencing Primer
(F):5'- TTACAGGCAGGCACAAGGACC -3'
(R):5'- GGCCTTGGAATTTGCAAAAAC -3'

Posted On

2018-03-15